ShRNA-Ago2 coexpression lentivirus RNAi vector, recombinant plasmid and constructing method of recombinant plasmid

A recombinant plasmid, cmv-ago2 technology, applied in the field of lentiviral RNAi vectors, can solve the problems of low transfection efficiency, affecting the high-level expression of shRNA, hindering the interference effect of shRNA, etc., achieving the effect of high efficiency and simple and efficient construction process

Inactive Publication Date: 2015-07-29
苟德明 +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the above experiments, the transfection efficiency of shRNA expression vectors in cells was not high, which affected the high-level expression of shRNA in cells; at the same time, the above-mentioned techniques were all for transient expression of vectors (that is, short-term expression), and it was difficult to maintain the stability of shRNA. Long-term effect; in addition, the conditions such as the type, structure and combination of gene expression functional elements used in the existing technology are not optimal, which also hinders the effective play of shRNA interference

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ShRNA-Ago2 coexpression lentivirus RNAi vector, recombinant plasmid and constructing method of recombinant plasmid
  • ShRNA-Ago2 coexpression lentivirus RNAi vector, recombinant plasmid and constructing method of recombinant plasmid
  • ShRNA-Ago2 coexpression lentivirus RNAi vector, recombinant plasmid and constructing method of recombinant plasmid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Construction of shRNA-Ago2 co-expression lentiviral RNAi vector

[0048] (1) Prepare the backbone pLVX-IRES-ZsGreen1-Puro for constructing the vector:

[0049] Using the pLVX-IRES-ZsGreen1 (Clontech) vector as a template, use the upstream primer (SEQ ID No: 1) TTTATCGATGGATCCTAACGCGTGAATTCGCCCCTCTCCCTC and the downstream primer (SEQ ID No: 2) GGTCTAGATCAGGGCAAGGCGGAGC to amplify the IRES-ZsGreen1 fragment, and use Cla1-Xba1 double enzyme digestion PCR The product was then cloned into the pLVX-Puro vector (Clontech) via the corresponding sites to obtain the pLVX-IRES-ZsGreen1-Puro vector backbone.

[0050] (2) Insert the enhancer Ago2 gene expression cassette CMV-Ago2:

[0051] The pIRESneo-FLAG / HA-Ago2 vector (purchased from Invitrogen, containing the CMV promoter and enhancer Ago2 sequence) was double digested with MluI and EcoRI to obtain a CMV-Ago2 fragment of about 3.3 kb, and the CMV-Ago2 fragment was combined with step (1 )’s pLVX-IRES-ZsGreen1-Puro ve...

Embodiment 2

[0059] Example 2 Construction of shRNA-Ago2 co-expression lentiviral RNAi vector

[0060](1) Prepare the backbone pLVX-IRES-ZsGreen1-Puro for constructing the vector: same as Example 1;

[0061] (2) Insert the enhancer factor Ago2 gene expression cassette CMV-Ago2: same as Example 1;

[0062] (3) Insert shRNA expression promoter

[0063] In this embodiment, the H1 promoter is used, and the primer sequences are SEQ ID No: 7-8 (see Table 2). The vector obtained by referring to the preparation method of Example 1 is: pLVX-H1-CMV-Ago2-IRES-ZsGreen1-Puro.

[0064] (4) Insert the ccdB sequence to obtain the complete shRNA-Ago2 co-expression lentiviral RNAi vector:

[0065] As in Example 1, the shRNA-Ago2 co-expression lentiviral RNAi vector whose vector backbone is pLVX-H1-ccdB-CMV-Ago2-IRES-ZsGreen1-Puro was obtained.

Embodiment 3

[0066] Example 3 Construction of shRNA-Ago2 co-expression lentiviral RNAi vector

[0067] Referring to Examples 1 and 2, the present invention can also use the 7SK promoter, the primer sequence is SEQ ID No: 9-10 (see Table 2), and the prepared vector backbone is pLVX-7SK-ccdB-CMV-Ago2-IRES-ZsGreen1 -Puro's shRNA-Ago2 co-expression lentiviral RNAi vector.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an shRNA-Ago2 coexpression lentivirus RNAi vector, a recombinant plasmid and a constructing method of the recombinant plasmid. The shRNA-Ago2 coexpression lentivirus RNAi vector includes an shRNA expression cassette and an Ago2 protein expression cassette, and the shRNA expression cassette includes a promoter U6, H1 or 7SK, and a ccdB lethal gene; and the Ago2 protein expression cassette includes a CMV strong promoter, an Ago2 protein expression gene, an internal ribosome entry site DNA sequence and a ZsGreen1 green fluorescin expression gene. After the vector is introduced into cells, shRNA for interfering the target gene and the enhancement factor Ago2 and ZsGreen1 green fluorescin report gene can be simultaneously expressed. The vector co-expresses Ago2 to substantially enhance the silencing effect of shRNA, the operation is simple and rapid, the effect and the lasting time of the RNAi interference gene are greatly improved, and the vector can be used to treat tumors and other serious diseases.

Description

technical field [0001] The invention belongs to the field of functional genomics research, and relates to a lentiviral RNAi vector, a recombinant plasmid and a construction method thereof. Background technique [0002] RNA interference (RNA interference, RNAi) is a highly conserved post-transcriptional silencing phenomenon in the evolutionary process, in which double-stranded RNA (double-stranded RNA, dsRNA) induces efficient and specific degradation of homologous mRNA (Fire A., Nature, 1998.391(6669): p.806-11.). RNAi technology not only reveals the mechanism of gene silencing in cells, but also is another effective research method for interpreting gene functions after yeast hybrid lines, DNA chips, gene knockout, antisense RNA and other technologies, and greatly promotes human beings to reveal the mysteries of life. process. The mechanism of RNA interference in cells is divided into three stages: the first is the initial stage, exogenous or endogenous double-stranded RNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/66
Inventor苟德明康康何洁凝李洁璇田生礼
Owner苟德明