Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antihuman ROR1 (receptor tyrosine kinase-like orphan receptor) monoclonal antibody and preparation method and application thereof

A monoclonal antibody and antibody technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and applications, can solve the problem of no ROR1-specific antibody, and achieve the effect of strong affinity, high yield and high purity

Active Publication Date: 2015-08-05
ACROBIOSYSTEMS INC
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] There are currently no specific antibodies against ROR1

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antihuman ROR1 (receptor tyrosine kinase-like orphan receptor) monoclonal antibody and preparation method and application thereof
  • Antihuman ROR1 (receptor tyrosine kinase-like orphan receptor) monoclonal antibody and preparation method and application thereof
  • Antihuman ROR1 (receptor tyrosine kinase-like orphan receptor) monoclonal antibody and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Using phage display technology to screen the variable region gene of anti-human ROR1 monoclonal antibody from the antibody library

[0040] 1.1 Human antibody library construction

[0041] The human antibody library was constructed according to Marks et al. J.Mol.Biol., 222, 581-597; Hoogenboom and Winte, J.Mol.Biol., 227, 381-388; Haidaris CG et al., J Immunol Methods.2001 Nov 1; 257(1-2):185-202; Griffiths, A.D. et al. EMBO J., 13, 3245-3260 (1994); Nissim, A. et al. EMBO J., 13, 692-698 (1994). Human Antibody Library.

[0042] In short, the genes of heavy and light chains of immunoglobulins were prepared from peripheral blood lymphocytes, amplified in vitro by PCR, and cloned into phage vectors. Human ROR1 protein (Cat#RO1-H522y, ACROBiosystems Inc) was used as the antigen, and the corresponding specific antibody was screened.

[0043] 1.2 Screening of human antibody library

[0044] Add 1.5 ml of the revived antibody library solution to 13 ml of fresh ...

Embodiment 2

[0055] Example 2 Sequencing of the coding sequence of the hypervariable region of the antibody and the acquisition of the complete sequence of the antibody

[0056] The cloned strains (1G8, 3F4) obtained in Example 1 were respectively amplified in 5 ml of LB medium, and the plasmid DNA was purified with a plasmid DNA extraction and purification kit (Cat#K1910-01) from Life technologies company.

[0057] The known human kappa and IgG1 sequences of human antibodies are used to design universal primers for the variable region, and PCR amplification is performed to obtain the light chain and heavy chain variable regions.

[0058] PCR primer: VL-F: 5'CGTACGGTGGCTGCACCATCT 3' (SEQ ID NO: 33);

[0059] VL-R: 5'CTAACACTCTCCCCTGTTGAAGCTC 3' (SEQ ID NO: 34);

[0060] VH-F: 5'GCTAGCACCAAGG GCCCATCGG 3' (SEQ ID NO: 35);

[0061] VH-R: 5' GATCCTCATTTACCCGGAGACAGGGAGAG GC 3' (SEQ ID NO: 36).

[0062] PCR reaction was carried out with PrimeSTAR HS DNA Polymerase (Takara, product number DR...

Embodiment 3

[0073] Example 3 Cloning and Construction of the Expression Vector of the Antibody Variable Region Coding Sequence

[0074] Using Gene from Life technologies Seamless Cloning and Assembly Kit (life technologies Cat#A13288) was used for vector construction. The heavy and light chains of 1G8 and 3F4 were constructed into UCOE vectors, respectively. UCOE vectors were purchased from Millipore Corporation.

[0075] Primer design:

[0076] UCOE-1G8-H-S: gttagttaagttaacggccggccATGGGCTGGTCCCTGATTC (SEQ ID NO: 13);

[0077] UCOE-1G8-H-AS: cgactacgtggccgcgctagcTTATTTACCCGGAGACAGGGAG (SEQ ID NO: 14);

[0078] UCOE-1G8-L-S: gttagttaagttaacggccggccATGGACTTCCAGGTCCAG (SEQ ID NO: 15);

[0079] UCOE-1G8-L-AS: cgactacgtggccgcgctagcTTAACACTCTCCCCTGTTGAAG (SEQ ID NO: 16);

[0080] UCOE-3F4-H-S: gttagttaagttaacggccggccATGGGCTGGTCCCTGATTC (SEQ ID NO: 17);

[0081] UCOE-3F4-H-AS: cgactacgtggccgcgctagcTTATTTACCCGGAGACAGGGAG (SEQ ID NO: 18);

[0082] UCOE-3F4-L-S: gttagttaagttaacggccggccATGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an antihuman ROR1 (receptor tyrosine kinase-like orphan receptor) monoclonal antibody and a preparation method and application thereof. The antibody is provided with a heavy chain variable region and a light chain variable region, each of the heavy chain variable region and the light chain variable region is provided with three CDRs (complementarity determining regions), the amino acid sequence of the CDR1 of the heavy chain variable region is SEQ ID NO:21 or NO:27, the amino acid sequence of the CDR2 is SEQ ID NO:22 or NO:28, and the amino acid sequence of the CDR3 is SEQ ID NO:23 or NO:29; the amino acid sequence of the CDR1 of the light chain variable region is SEQ ID NO:24 or NO:30, the amino acid sequence of the CDR2 is SEQ ID NO:25 or NO:31, and the amino acid sequence of the CDR3 is SEQ ID NO:26 or NO:32. The antibody is good in monomer stability and high in specificity, specific markers of the leukemia can be detected in advance by monitoring specific cells, ROR1 targets in breast cancer cells can be further combined, and silence experiment completion is facilitated.

Description

technical field [0001] The present invention relates to an anti-human ROR1 monoclonal antibody and its preparation method and application, in particular to a humanized anti-human ROR1 monoclonal antibody and its preparation method, and the tracer of the monoclonal antibody in the treatment of cancer cells and targeted applications. Background technique [0002] The receptor tyrosine kinase-like orphan receptor-1 (ROR1) protein, originally discovered in the 1990s, was called an orphan receptor because its function was unknown. Later, some researchers found that ROR1 can be expressed at a high level during embryonic development and plays an important role in the regulation of embryonic muscle and bone development. But during subsequent fetal development, expression of the protein is switched off, and ROR1 is not normally expressed in normal cells and tissues in adults. However, cancer cells are an exception. [0003] In 2008, Dr. Kipps' research group found that the interac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/28C12N15/13C12N5/10C12P21/08C12R1/91
Inventor 康平苗景赟陈宜顶
Owner ACROBIOSYSTEMS INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com