Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and method for detecting EZH2 genes

A technology for sequencing primers and genes, which is applied in the fields of life science and biology, can solve problems such as poor prognosis, and achieve the effect of reducing cost and difficulty, making detection difficult and costly

Inactive Publication Date: 2015-08-26
SHANGHAI ADICON CLINICAL LAB LNC
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the specific mechanism leading to MDS is not yet clear, but the mutation detection of EZH can undoubtedly indicate a poor prognosis to a certain extent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for detecting EZH2 genes
  • Primer and method for detecting EZH2 genes
  • Primer and method for detecting EZH2 genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] A primer for detecting polymorphic mutation sites of the EZH2 gene, the design of the primers is specific amplification primers designed for EZH2 mutation hotspots, including:

[0058] The primers for amplifying the EZH2 gene containing exons 7, 8, and 17, the base sequences of which are:

[0059] EZH2-7F: TGTAAAACGACGGCCAGTTTTTTGTTTTTTGACTGACTGGCA

[0060] EZH2-7R: AACAGCTATGACCATGAAACAAAGTGTAGTGGCTCATCC

[0061] EZH2-8F: TGTAAAACGACGGCCAGTATTCTTGATAACACCATGCACAA

[0062] EZH2-8R: AACAGCTATGACCATGCAGAGCAATCCTCAAGCAACA

[0063] EZH2-17F: TGTAAAACGACGGCCAGTGGTCCAGTATTCACTCTGTGCG

[0064] EZH2-17R: AACAGCTATGACCATGCACTGACCCTCTACCCTCGTTTC

[0065] A kit for detecting polymorphic mutation sites of the EZH2 gene, comprising

[0066] (i) Blood DNA extraction reagents;

[0067] (ii) detection system PCR reaction solution;

[0068] (iii) Sequencing system reagents;

[0069] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as T...

Embodiment 2

[0073] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0074] (1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step ...

Embodiment 3

[0101] The clinical samples of 24 MDS patients (sample numbers are 1-24) were taken according to the reagents and methods of Examples 1 and 2 to extract genomes, prepare reagents, amplify and sequence. Add 1 μl of each sample to the detection system PCR reaction solution. Electrophoresis results such as figure 2 , 3 , 4, it shows that the primers EZH2-7F / R, EZH2-8F / R, EZH2-17F / R of the present invention can effectively amplify the blood sample, and the band is single.

[0102] The test results of samples 1, 2, and 3 are as follows: Figure 5 , 6 , 7 shows:

[0103] Figure 5 It shows a screenshot of the wild-type sequencing of exon EZH27 of sample 1, indicating that exon 7 of sample 1 is not mutated.

[0104] Figure 6 It shows a screenshot of the wild-type sequencing of exon EZH28 of sample 2, indicating that exon 8 of sample 2 is not mutated.

[0105] Figure 7 It shows the wild-type sequencing screenshot of exon EZH217 of sample 3, indicating that exon 17 of sampl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer and method for detecting bone marrow hyperplasia exceptional syndromes, particularly for EZH2 gene mutation of exceptional syndrome patients. The method comprises the following steps: (i) amplifying the primer of the sequence of the 7th, 8th and 17th exons of EZH2 genes; adopting a Sanger sequencing technique and a sequencing primer. The primer and method, disclosed by the invention, can quickly detect the mutation of the 7th, 8th and 17th exons of EZH2 genes in a patient with a bone marrow hyperplasia exceptional syndrome; the detecting results are accurate, and can provide poor prognosis indices for myeloid malignant hematonosis (including MDS).

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and in particular relates to primers for detecting the mutation rate of exons 7, 8, and 17 of EZH2 gene, which can be used for rapid detection of EZH2 gene in patients with myelodysplastic syndrome by using common PCR technology and Sanger sequencing Mutations at polymorphic sites. Background technique [0002] Myelodysplastic syndromes (MDS) are a group of heterogeneous clonal disorders characterized by cytopenias, abnormal development of one or more lineages of myeloid cells, ineffective hematopoiesis, bone marrow hematopoietic failure, and progression to acute myeloid leukemia The risk increases. In recent years, it has been found that MDS patients have mutations in epigenetic regulator genes such as EZH2, suggesting that mutations in these genes may be involved in the occurrence of MDS. [0003] The EZH2 gene is located on human chromosome 7, with a total length of 76978bp and a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/156
Inventor 林筱剑陈奕磊王淑一
Owner SHANGHAI ADICON CLINICAL LAB LNC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com