Primer and method for detecting EZH2 genes
A technology for sequencing primers and genes, which is applied in the fields of life science and biology, can solve problems such as poor prognosis, and achieve the effect of reducing cost and difficulty, making detection difficult and costly
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] A primer for detecting polymorphic mutation sites of the EZH2 gene, the design of the primers is specific amplification primers designed for EZH2 mutation hotspots, including:
[0058] The primers for amplifying the EZH2 gene containing exons 7, 8, and 17, the base sequences of which are:
[0059] EZH2-7F: TGTAAAACGACGGCCAGTTTTTTGTTTTTTGACTGACTGGCA
[0060] EZH2-7R: AACAGCTATGACCATGAAACAAAGTGTAGTGGCTCATCC
[0061] EZH2-8F: TGTAAAACGACGGCCAGTATTCTTGATAACACCATGCACAA
[0062] EZH2-8R: AACAGCTATGACCATGCAGAGCAATCCTCAAGCAACA
[0063] EZH2-17F: TGTAAAACGACGGCCAGTGGTCCAGTATTCACTCTGTGCG
[0064] EZH2-17R: AACAGCTATGACCATGCACTGACCCTCTACCCTCGTTTC
[0065] A kit for detecting polymorphic mutation sites of the EZH2 gene, comprising
[0066] (i) Blood DNA extraction reagents;
[0067] (ii) detection system PCR reaction solution;
[0068] (iii) Sequencing system reagents;
[0069] Among them, the tissue DNA extraction reagent can be purchased from commercial reagents such as T...
Embodiment 2
[0073] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):
[0074] (1) Extract tissue DNA from blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inverting, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12,000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous step ...
Embodiment 3
[0101] The clinical samples of 24 MDS patients (sample numbers are 1-24) were taken according to the reagents and methods of Examples 1 and 2 to extract genomes, prepare reagents, amplify and sequence. Add 1 μl of each sample to the detection system PCR reaction solution. Electrophoresis results such as figure 2 , 3 , 4, it shows that the primers EZH2-7F / R, EZH2-8F / R, EZH2-17F / R of the present invention can effectively amplify the blood sample, and the band is single.
[0102] The test results of samples 1, 2, and 3 are as follows: Figure 5 , 6 , 7 shows:
[0103] Figure 5 It shows a screenshot of the wild-type sequencing of exon EZH27 of sample 1, indicating that exon 7 of sample 1 is not mutated.
[0104] Figure 6 It shows a screenshot of the wild-type sequencing of exon EZH28 of sample 2, indicating that exon 8 of sample 2 is not mutated.
[0105] Figure 7 It shows the wild-type sequencing screenshot of exon EZH217 of sample 3, indicating that exon 17 of sampl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 