Novel exonuclease-III-based mercury ion detection method

A technology of exonuclease and mercury ions, which is applied in the field of analytical chemistry technology and food safety, and can solve the problems of expensive equipment and complicated pretreatment

Inactive Publication Date: 2015-09-30
CHANGSHU INSTITUTE OF TECHNOLOGY
View PDF5 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although these traditional methods have their own advantages, they still have many limitations in practical application, such as expensive instruments and equipment, complicated pretreatment, and the need for skilled technicians, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel exonuclease-III-based mercury ion detection method
  • Novel exonuclease-III-based mercury ion detection method
  • Novel exonuclease-III-based mercury ion detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1 Design and synthesis of corresponding oligonucleotide fragments

[0025] By consulting relevant literature, design two pieces of DNA fragments that can specifically recognize mercury ions and are rich in T bases, and design upstream and downstream primers for real-time fluorescent quantitative PCR based on the sequences. Sequences were prepared by a DNA synthesizer.

[0026] Template DNA: 5'- AATCTGGTTTAGCTACGCCTTCCCCGTGGCGATGTTTCTT

[0027] AGCGCCTTACTTGTTTGTTG-3' (SEQ ID NO: 1)

[0028] Complementary DNA: 5'-CTTCTTTCTTGTAAGGCGCTAAGAAACATCGCCACGGG

[0029] GAAGGCGTACTCGCG-3' (SEQ ID NO: 2)

[0030] Upstream primer: 5'-AATCTGGTTTAGCTACGCCTTC-3' (SEQ ID NO: 3)

[0031] Downstream primer: 5'-GTAAGGCGCTAAGAAACATCG-3' (SEQ ID NO: 4)

Embodiment 2

[0032] Example 2 T-Hg 2+ -T hybridization reaction

[0033] First, add the mixture of template DNA and complementary DNA to the PCR tube, and then add an appropriate amount of Hg 2+ The ion standard solutions were made to have final concentrations of 2, 5, 10, 20, 50, 100, and 200 nM, respectively, and reacted for 30 min. Template DNA and Complementary DNA by T-Hg 2+ The -T-specific structure forms double-stranded DNA with a closed 3' end.

Embodiment 3

[0034] Enzyme catalysis of embodiment 3 exonuclease III and establishment of standard curve

[0035] Add 0.1 μL of exonuclease III to the above-mentioned PCR tubes in turn, react for 90 s, and then react the whole system in a constant temperature metal bath at 98°C for 10 min to inactivate exonuclease III and end the reaction of exonuclease III. Shearing of template DNA. Then add an appropriate amount of PCR mixture, after the upstream and downstream primers in CFX96 TM Experiments were completed in real-time fluorescent quantitative PCR. Due to the added Hg 2+ Different ion concentrations lead to different amounts of template DNA being cut off by exonuclease III, and the concentration of template DNA used for PCR amplification is also different, so different amplification curves are obtained ( figure 1 ). The establishment of the mercury ion standard curve: Utilize the real-time fluorescent quantitative PCR instrument to measure the number of cycles of the amplification c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel exonuclease-III-based mercury ion detection method which comprises the following steps: (1) mixing two DNA (deoxyribonucleic acid) segments, which can specifically recognize mercury ions and contain rich T bases, with a sample to be detected so that the two DNA segments are combined into a 3'-terminal closed double-chain DNA under the action of Hg<2+> in the sample to be detected; (2) carrying out enzyme digestion on the double-chain DNA by using exonuclease III; (3) carrying out fluorescent quantitative PCR (polymerase chain reaction) amplification on the rest DNA segments which are not subjected to enzyme digestion; and (4) determining the Hg<2+> concentration according to the fluorescent detection result. The invention designs a mercury ion biosensor which is used for implementing simple quick high-sensitivity detection on the mercury ions in water.

Description

technical field [0001] The invention belongs to the technical fields of analytical chemistry and food safety, and relates to a new mercury ion detection method based on exonuclease III. Background technique [0002] Mercury mainly exists in nature in the form of inorganic mercury and organic mercury. Inorganic mercury will be converted into organic mercury through methylation in nature. Different states of mercury have different hazards to the human body, among which organic mercury is the most harmful to the human body. Mercury will accumulate in the human body through the enrichment of the food chain, causing harm to human health. For example: severely damage the brain and nervous system of the human body, and seriously affect the functions of the immune system, digestive system, kidney and lungs, etc. Therefore, it is still necessary to develop a new method for simple and rapid detection of mercury ions. [0003] Traditional methods for determining the concentration...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q2521/319C12Q2545/113
Inventor朱颖越邓大庆朱敏李海霞蔡义林袁爱梦王立梅齐斌
OwnerCHANGSHU INSTITUTE OF TECHNOLOGY