Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for increasing gel content of eucommia ulmoides

A technology of glue content and cambium, applied in the fields of botanical equipment and methods, biochemical equipment and methods, angiosperms/flowering plants, etc., can solve problems such as undisclosed related gene application methods, and achieve the goal of increasing glue content Effect

Active Publication Date: 2015-10-21
CHINA PAULOWNIA RES CENT
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the genes related to Eucommia rubber synthesis have been cloned and transformed, the application methods of the related genes have not yet been revealed

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for increasing gel content of eucommia ulmoides
  • Method for increasing gel content of eucommia ulmoides
  • Method for increasing gel content of eucommia ulmoides

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0037] Example 2 Isolation and cloning of EuTIDS5 gene

[0038] Using the Eucommia transcriptome database, a sequence of EuTIDS5 was obtained. The present invention adopts the method of RACE to amplify the complete sequence of EuTIDS5 by using the 5' and 3'-RACE kits of Taraka Company (TaKaRa, Dalian, China). RNA was extracted using QiAgen RNA Extraction Kit (RNeasy Plant mini Kit, QiAgen, Hilden, Germany), and the first strand of cDNA was synthesized according to Inviterogen’s SuperScript TM III First-Strand Synthesis System (Life technologies, Carlsbad, California, U.S.) reverse transcription kit, all were operated according to the kit instructions.

[0039] Use PrimerPremier 5.0 to design primers for the EuTIDS5 sequence for amplification. The primers are as follows:

[0040] Core Fragment Forward (SEQ ID NO:5):

[0041] 5'-AAGGTTGGGATGATTGCGAT-3'

[0042] Core fragment reverse (SEQ ID NO:6):

[0043] 5'-TTTCACGACTAACCAAGTGC-3'

[0044] 5'RACE OuterPrimer (SEQ ID NO: ...

Embodiment 3

[0071] Example 3 Analysis of the expression rule of EuTIDS5

[0072] In order to analyze the relationship between the expression of EuTIDS5 gene in different tissues in different periods and the rubber content, the present invention adopts real-time quantitative PCR (Real-Time PCR), and the reaction is according to the SYBR Premix Ex Taq of TaKaRa Company TM The operation is carried out according to the instructions of the kit, and the two-step method (amplification curve and melting curve curve) is used for amplification. The relative expression of EuTIDS5 in leaves and fruits of Eucommia ulmoides in different periods was analyzed, and the RNA extraction and cDNA synthesis of leaves and fruits of Eucommia ulmoides were the same as in Example 1. The primer used is the housekeeping gene ACTIN forward (SEQ ID NO: 13):

[0073] 5'-TGAGATGCACCACGAAGCTC-3'

[0074] Reverse (SEQ ID NO:14):

[0075] 5'-CCAACATTGTCACCAGGAAGTG-3',

[0076] and gene-specific primer forward (SEQ ID N...

Embodiment 4

[0080] The construction of embodiment 4 plant expression vectors

[0081] The invention adopts the Gateway method to construct the overexpression vector 35S::EuTIDS5 of the key enzyme gene of rubber synthesis and the RNA interference vector RNAi-EuTIDS5. According to the construction requirements of the Gateway vector (which has been circulated and used by major scientific research institutions in my country, here presented by the Chen Jun Deputy Research Institute of the Chinese Academy of Forestry Sciences): cloning of the target fragment, construction of the entry vector, and construction of the expression vector.

[0082] 1. Cloning of the target fragment

[0083] Utilize Primer Premier 5.0 to design primers and add sequences with Gateway adapters at both ends of the primers as follows (the underlined part is the Gateway adapter sequence) to overexpress the primers:

[0084] Forward (SEQ ID NO:17):

[0085] 5'– GGGGACAACTTTGTACAAAAAAGTTGGA ATGGCGGAAACGACCCA-3'

[0086...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for increasing the gel content of eucommia ulmoides. The method includes the following steps: firstly, phloem of eucommia ulmoides bark is peeled off to form multiple cells, and cambium on the surface is exposed out in an interval cell shape; secondly, the dip dyeing operation is conducted, wherein bacterium liquid cultivated through single agrobacterium colonies containing EuTIDS5 recombinant expression vectors is picked to infect the cambium on the surface of peeled eucommia ulmoides; and thirdly, the peeled face is wrapped with a plastic film after peeling and infecting are conducted, and moisture preservation and sun protection growth is achieved. The infecting method is simple, feasible and excellent in gel content increasing effect.

Description

technical field [0001] The invention relates to a method for increasing the gum content of Eucommia ulmoides, in particular to a method for increasing the gum content of Eucommia ulmoides through specific gene introduction. Background technique [0002] Eucommia ulmoides Oliv. is a rare and precious medicinal tree species unique to my country, and its bark, root, stem, leaf, flower and fruit all contain a large amount of white filamentous substance-Eucommia ulmoides Rubber (EUR ), so Eucommia is known as a high-quality natural rubber tree species. Rubber is an important strategic material resource of our country, and the rubber industry is one of the most important basic industries of our national economy. The suitable growth area of ​​clover rubber in my country is very narrow, and the production capacity has reached the limit. Domestic demand for natural rubber far exceeds domestic production, and the lack of natural rubber resources restricts the development of my countr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84A01H5/00
Inventor 乌云塔娜王淋杜兰英杜红岩
Owner CHINA PAULOWNIA RES CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com