Check patentability & draft patents in minutes with Patsnap Eureka AI!

Preparation method and application of LcGa recombinant protein of galaptins of larimichthys crocea

A galectin and recombinant protein technology is applied in the field of preparation of large yellow croaker galectin LcGa recombinant protein, can solve problems such as limitation, difficulty in maintaining biological activity, difficulty in renaturation of inclusion bodies, etc., and achieves a simple preparation method, The effect of maintaining the natural biological activity and the preparation method is simple and easy to operate

Inactive Publication Date: 2015-11-18
JIMEI UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Most of the fish lectins reported so far are C-type lectins and exist in the form of inclusion bodies, which have problems such as difficult renaturation and difficulty in maintaining biological activity. Therefore, they are largely restricted in practical applications. limit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of LcGa recombinant protein of galaptins of larimichthys crocea
  • Preparation method and application of LcGa recombinant protein of galaptins of larimichthys crocea
  • Preparation method and application of LcGa recombinant protein of galaptins of larimichthys crocea

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0049] The present invention is further explained below in conjunction with the examples, but the examples do not limit the present invention in any form.

[0050] 1. Construction of pGEX-6P1-LcGa recombinant expression vector

[0051] (1) PCR amplification of LcGa gene

[0052] The total RNA of the spleen of large yellow croaker was extracted, and the cDNA of the spleen was amplified with OligdT as primer. According to the large yellow croaker transcriptome data (measured in our laboratory), the primers were designed as follows:

[0053] GF:CCG GAATTC ATGGCTTTCCATCAGCAGTCAC (the underlined part is the BamHI restriction site);

[0054] GR:CCG CTCGAG CACAATCACAGATGTCAGACTG The underlined part is the EcoRI restriction site).

[0055] Using the spleen cDNA of large yellow croaker as a template, the LcGa gene of about 1000bp was amplified with primer GF / R.

[0056] (2) The PCR product and pGEX-6P1 were simultaneously digested with BamHI and EcoRI and recovered, and then li...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method and an application of LcGa recombinant protein of galaptins of larimichthys crocea, and relates to genetic engineering. The preparation method comprises steps as follows: 1), a pGEX-6P1-LcGa recombinant expression vector is constructed; 2), an escherichia coli expression strain pGEX-6P1-LcGa-BL21 with high-copy transformants is acquired; 3), fermented cultivation and induced expression of the transformants are performed; the recombinant protein LcGa is purified. The LcGa recombinant protein of galaptins of the larimichthys crocea can be applied to mediated bacteria agglutination and mediated red blood cell agglutination, and can be applied to preparation of fish immune additives and bacterial control drugs. The prokaryotic expression recombinant protein exists in a soluble mode, and the natural bioactivity of the recombinant protein is kept; further, the preparation method is simple and easy to operate, the yield is high, the low-cost scale production becomes possible, and a new way is provided for development of the novel fish immune additives and the bacterial control drugs.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a preparation method and application of a large yellow croaker galectin LcGa recombinant protein. Background technique [0002] Large yellow croaker is one of the seawater economic fishes with the largest breeding volume in my country, and it is also the most characteristic seawater cultured fish in Fujian Province, with an annual direct output value of several billion yuan. However, with the large-scale development of large yellow croaker farming, disease problems are becoming more and more serious, causing hundreds of millions of yuan in economic losses every year, seriously affecting the economic and ecological benefits of large yellow croaker farming. The pathogens of large yellow croaker are complex and changeable, including viruses, bacteria, parasites and other undiagnosed new pathogens, among which Vibrio and Cryptocaryon irritatus infections are the most seri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C07K14/46C07K1/16A23K1/18A23K1/16A61K38/17A61P31/04
Inventor 张东玲吕常欢王志勇
Owner JIMEI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More