Preparation method and application of fish-derived galactose lectin CaGal recombinant protein
A technology of galectin and recombinant protein, which is applied in the field of molecular biology of aquatic animals, can solve the problem of less galectin, and achieve the effect of simple preparation method and inhibition of Aeromonas hydrophila
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0033] Expression and Purification of CaGal Recombinant Protein
[0034] 1. Construction of pET-32a-CaGal recombinant expression vector
[0035] (1) PCR amplification of CaGal gene
[0036] The total RNA of the Qihe crucian carp liver was extracted, and the cDNA was synthesized with OligdT as a primer. According to the cDNA sequence of CaGal obtained in our laboratory, the primers were designed as follows:
[0037] Forward primer F: CGG GGTACC ATGGCTTTTTATCAGCAACAGCCGT (the underlined part is Kpn I restriction site);
[0038] Reverse primer R: CCC AAGCTT TTAAGCCTGCACAAAAGTCAGCTGC (the underlined part is Hind III restriction site);
[0039] Using the Qihe crucian carp liver cDNA as a template, the 963bp CaGal sequence was amplified with primers F / R.
[0040] The reaction conditions were: pre-denaturation at 95°C for 5 minutes; 30 cycles of 95°C for 30 s, 63°C for 30 s, and 72°C for 1 min; final extension at 72°C for 10 min.
[0041] (2) Carry out the CaGal PCR produ...
Embodiment 2
[0061] Inhibition and removal ability of CaGal recombinant protein against Aeromonas hydrophila
[0062] 1. Inhibitory effect of CaGal recombinant protein on Aeromonas hydrophila
[0063] The inhibitory effect of the CaGal recombinant protein on Aeromonas hydrophila was detected by the tube-and-disk method, and the specific steps were as follows:
[0064] (1) Pick a single bacterial colony from the LB plate and insert it into 3 mL LB liquid medium for overnight culture;
[0065] (2) The next day, the overnight cultured bacteria were inoculated into fresh LB liquid medium at a ratio of 1:100, and cultivated to the logarithmic growth phase;
[0066] (3) Evenly spread 100 μL of bacterial solution in the logarithmic growth phase on the LB plate;
[0067] (4) Design and place 4 sterilized Oxford cuvettes on the LB plate, mark the bottom of the plate, add 50 μL CaGal recombinant protein (0.5 mg / mL) to the Oxford cuvette, and use 50 μL Kanamycin for positive control rTrx protein (...
Embodiment 3
[0074] CaGal recombinant protein improves the survival rate of Qihe crucian carp infected by Aeromonas hydrophila
[0075](1) Using LB liquid medium for overnight shaking culture, Aeromonas hydrophila reached the logarithmic growth phase. Centrifuge at 5000rpm for 5min, wash the bacteria twice with 0.65wt% NaCl and resuspend to make the concentration of the bacteria liquid reach 6.25×10 6 CFU / mL. Randomly divide Qihe crucian carp (15-20g) into 3 groups, 20 in each group. Respectively intraperitoneal injection: Group 1 (normal saline group), 100 μL Aeromonas hydrophila bacteria solution + 100 μL 0.65wt% NaCl; Group 2 (rTrx protein group), 100 μL Aeromonas hydrophila bacteria solution + 20 μg rTrx protein; group 3 (CaGal protein group), 100 μL of Aeromonas hydrophila culture + 20 μg of CaGal recombinant protein. Each group was first injected with 100 μL of Aeromonas hydrophila bacteria solution, and then injected with 0.65wt% NaCl, rTrx protein and CaGal recombinant protein a...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com