Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Preparation method and application of fish-derived galactose lectin CaGal recombinant protein

A technology of galectin and recombinant protein, which is applied in the field of molecular biology of aquatic animals, can solve the problem of less galectin, and achieve the effect of simple preparation method and inhibition of Aeromonas hydrophila

Inactive Publication Date: 2018-08-17
HENAN NORMAL UNIV
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, few galectins have been identified from fish so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of fish-derived galactose lectin CaGal recombinant protein
  • Preparation method and application of fish-derived galactose lectin CaGal recombinant protein
  • Preparation method and application of fish-derived galactose lectin CaGal recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0033] Expression and Purification of CaGal Recombinant Protein

[0034] 1. Construction of pET-32a-CaGal recombinant expression vector

[0035] (1) PCR amplification of CaGal gene

[0036] The total RNA of the Qihe crucian carp liver was extracted, and the cDNA was synthesized with OligdT as a primer. According to the cDNA sequence of CaGal obtained in our laboratory, the primers were designed as follows:

[0037] Forward primer F: CGG GGTACC ATGGCTTTTTATCAGCAACAGCCGT (the underlined part is Kpn I restriction site);

[0038] Reverse primer R: CCC AAGCTT TTAAGCCTGCACAAAAGTCAGCTGC (the underlined part is Hind III restriction site);

[0039] Using the Qihe crucian carp liver cDNA as a template, the 963bp CaGal sequence was amplified with primers F / R.

[0040] The reaction conditions were: pre-denaturation at 95°C for 5 minutes; 30 cycles of 95°C for 30 s, 63°C for 30 s, and 72°C for 1 min; final extension at 72°C for 10 min.

[0041] (2) Carry out the CaGal PCR produ...

Embodiment 2

[0061] Inhibition and removal ability of CaGal recombinant protein against Aeromonas hydrophila

[0062] 1. Inhibitory effect of CaGal recombinant protein on Aeromonas hydrophila

[0063] The inhibitory effect of the CaGal recombinant protein on Aeromonas hydrophila was detected by the tube-and-disk method, and the specific steps were as follows:

[0064] (1) Pick a single bacterial colony from the LB plate and insert it into 3 mL LB liquid medium for overnight culture;

[0065] (2) The next day, the overnight cultured bacteria were inoculated into fresh LB liquid medium at a ratio of 1:100, and cultivated to the logarithmic growth phase;

[0066] (3) Evenly spread 100 μL of bacterial solution in the logarithmic growth phase on the LB plate;

[0067] (4) Design and place 4 sterilized Oxford cuvettes on the LB plate, mark the bottom of the plate, add 50 μL CaGal recombinant protein (0.5 mg / mL) to the Oxford cuvette, and use 50 μL Kanamycin for positive control rTrx protein (...

Embodiment 3

[0074] CaGal recombinant protein improves the survival rate of Qihe crucian carp infected by Aeromonas hydrophila

[0075](1) Using LB liquid medium for overnight shaking culture, Aeromonas hydrophila reached the logarithmic growth phase. Centrifuge at 5000rpm for 5min, wash the bacteria twice with 0.65wt% NaCl and resuspend to make the concentration of the bacteria liquid reach 6.25×10 6 CFU / mL. Randomly divide Qihe crucian carp (15-20g) into 3 groups, 20 in each group. Respectively intraperitoneal injection: Group 1 (normal saline group), 100 μL Aeromonas hydrophila bacteria solution + 100 μL 0.65wt% NaCl; Group 2 (rTrx protein group), 100 μL Aeromonas hydrophila bacteria solution + 20 μg rTrx protein; group 3 (CaGal protein group), 100 μL of Aeromonas hydrophila culture + 20 μg of CaGal recombinant protein. Each group was first injected with 100 μL of Aeromonas hydrophila bacteria solution, and then injected with 0.65wt% NaCl, rTrx protein and CaGal recombinant protein a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method and application of a fish-derived galactose lectin CaGal recombinant protein, and belongs to the field of aquatic animal molecular biology. According to the technical scheme, the cDNA of Qihe crucian carp Carassius auratus is took as a template, F / R is used as the primer for carrying out PCR amplification, the PCR product CaGal is connected with a carrier pET-32a to construct pET-32a-CaGal recombinant expression vector; the vector is transformed into escherichia coli BL21 (DE3) to obtain the escherichia coli expression strain pET-32a-CaGal-BL21 which can express the galactose lectin CaGal recombinant protein, and the galactose lectin CaGal recombinant protein can be obtained through separation and purification. The galactose lectin CaGal recombinant protein can keep the natural biological activity, so that pathogenic bacteria such as aeromonas hydrophila can be effectively inhibited, the antibacterial effect is obvious, and the preparation method is simple and can be used as a novel fish immune additive or an antibacterial drug.

Description

technical field [0001] The invention belongs to the technical field of aquatic animal molecular biology, and in particular relates to a preparation method and application of a fish source galectin CaGal recombinant protein. Background technique [0002] Qihe crucian carp, Carassius auratus ), also known as "double-backed crucian carp", is a natural triploid fish produced in the Qi River in northern Henan. It grows rapidly, has delicious meat and high nutritional value. One of the high-quality aquatic species. In recent years, with the expansion of the breeding range and density of crucian carp in the Qihe River, the immunity of fish has declined, leading to a gradual increase in diseases. Among them, the most harmful is the bacterial hemorrhagic disease of freshwater fish caused by Aeromonas hydrophila. The disease spreads rapidly and has a high mortality rate, seriously affecting the economic and ecological benefits of the Qihe crucian carp breeding industry. Therefore,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/46C12N15/70C12N1/21A61K38/17A61P37/04A61P31/04C12R1/19
CPCA61K38/00A61P31/04A61P37/04C07K14/461C12N15/70
Inventor 孔祥会王莉张杰赵贤亮裴超
Owner HENAN NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com