Cytomembrane positioning signal peptide and coding sequence and application thereof

A technology for locating signals and cell membranes, applied in the field of genetic engineering, can solve problems such as difficult to treat diseases, difficult to meet the needs of breeding development, etc., and achieve the effect of high-efficiency drug delivery

Active Publication Date: 2015-11-25
YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current vaccines have the following problems: one is that most of them are vaccines that stimulate humoral immunity, and these vaccines are difficult to treat diseases caused by viruses, parasites and bacteria parasitic in cells; the other is that most of the existing vaccines are single or monovalent Vaccines, while there are many types of pathogens in fish farming in my country, single or monovalent vaccines for diseases caused by one pathogen have been difficult to meet the needs of aquaculture development

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cytomembrane positioning signal peptide and coding sequence and application thereof
  • Cytomembrane positioning signal peptide and coding sequence and application thereof
  • Cytomembrane positioning signal peptide and coding sequence and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1 Identification of Transit Signal Peptide

[0034] 1. Construction of recombinant plasmids

[0035] 1. DNA template preparation: Genomic DNA of Edwardsiella tarda LSE40 was extracted.

[0036]2.PCR amplification: with the DNA of step 1 as template, 108For(AT CATATG CCTTGGATGCCACGATTGC, the underline is the NdeI restriction site) and 108Rev( GAATTC TCGGCCTTGGCCTTTTGCTCGGCCT, the underline is the EcoRI restriction site) for PCR amplification to obtain a PCR product with a size of 324bp. The PCR amplification system (50μl) is: 10×buffer5μl, MgCl 2 (25mM) 5μl, dNTPmixture (10mMeach) 1μl, PfuTaqpolymerase (5U / μl) 0.5μl, 108For (10μM) 1μl, 108Rev (10μM) 1μl, DNA template 1μl, the rest add ddH 2 O. The PCR amplification conditions were: 94°C for 5 minutes; 35 cycles of 94°C for 30s, 55°C for 30s, and 72°C for 30s; 72°C for 10 minutes.

[0037] 3. Digestion: the PCR product in step 2 was double-digested with restriction endonucleases NdeI and EcoRI (37° C. for ...

Embodiment 2

[0073] Implementation 2 Localization detection of fusion protein in flounder cells

[0074]1. Cultivation of recombinant bacteria: Inoculate LSE40pCX341 and LSE40pCX108 in TSB medium respectively, culture on a shaking table at 25°C for 18 hours, and transfer the bacterial solution to fresh TSB medium at a ratio of 1:20 (v:v) After culturing for 5 hours, take the bacterial solution and centrifuge at 5000g for 10 minutes at 4°C to collect the bacterial cells, wash three times with PBS and resuspend, adjust the bacterial concentration to 10 7 cells / ml.

[0075] 2. Infected flounder: buy flounder (Paralichthysolivaceus) from a farm and raise them temporarily in the aquarium for a week, then take 3 fishes, take internal organs for bacterial isolation, and use them for experiments after testing that there is no bacterial infection. Divide the flounder into two groups, 20 tails / group, respectively take the LSE40pCX341 and LSE40pCX108 bacterial solutions in step 1 and inject flounder...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering technologies, in particular to cytomembrane positioning signal peptide and coding sequence and application thereof. According to the cytomembrane positioning signal peptide and coding sequence and application, (a) or (b) serves as the signal peptide; (a) is polypeptide composed of an amino acid sequence as shown in a sequence 2 in a sequence table; (b) is derivative polypeptide with a cytomembrane positioning signal peptide function and formed by conducting replacing and / or deletion and / or adding of one or more amino acid residues on the amino acid sequence of the sequence 2. The signal peptide can locate target protein to the host cytomembrane. The cytomembrane positioning signal peptide and proper target protein form infused protein to be used for developing vaccine and medicine for treating virus, parasites and bacterial infection and achieve efficient dosing.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a cell membrane localization signal peptide and its coding sequence and application. Background technique [0002] Bacteria living in different environments respond to changes in the environment by secreting proteins with various biological functions to the cell surface or outside the cell to maintain their own survival and reproduction in the environment. Pathogens have a variety of protein secretion systems. Under different environmental conditions, they will use different protein secretion systems to interact with the host, secrete active proteins into host tissues or cells, and exert different physiological functions. Gram-negative bacteria have six protein secretion systems (I-VI). Different pathogenic bacteria have different protein secretion systems, and different protein secretion systems have different secretion mechanisms. According to the secretion pathway...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/24C12N15/31C12N15/85C12N5/10
CPCC07K14/24
Inventor莫照兰李贵阳李杰
OwnerYELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI