A kind of legionella rapid detection and typing kit and its detection method

A Legionella and kit technology, which is applied in the Legionella rapid detection and typing kit and its detection field, can solve the problems of complex result judgment, cumbersome operation, and low accuracy of detection results, and achieve simple operation and accurate detection results , the effect of improving the detection efficiency

Active Publication Date: 2017-06-13
GUANGZHOU KINGMED DIAGNOSTICS CENT
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to solve the defects of cumbersome operation, complex result judgment and low accuracy of detection results in the Legionella kit in the prior art, the present invention provides a Legionella rapid detection and typing kit and its detection method to solve the above problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of legionella rapid detection and typing kit and its detection method
  • A kind of legionella rapid detection and typing kit and its detection method
  • A kind of legionella rapid detection and typing kit and its detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1, primer

[0038] The invention provides a primer for rapid detection and typing of legionella.

[0039] Table 1 Primers provided by the present invention

[0040]

Embodiment 2

[0041] Embodiment 2, the pairing of primer and its amplified fragment size

[0042] The Legionella pneumophila 16s rRNA gene single nucleotide polymorphism site-specific primers provided by the present invention are respectively paired with Legionella specific primers to amplify a sequence within 261bp; GL261F-(LPA 628 R) The amplified fragment of the primer pair is 203bp; (LP-C 629 F) The amplified sequence of -GL261R primer pair is 97bp.

[0043] Table 2 The pairing of primers and the size of their amplified fragments

[0044]

[0045] in:

[0046] (1) The nucleotide sequence amplified by GL261F and GL261R primers is:

[0047] GGAGGGTTGATAGGTTAAGAGCTGATTAACTGGACGTTACCCACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTGATTAAGTTATCTGTGAAATTCCTGGGCTTAACCTGGGACGGTCAGATAATACTGGTTGACTCGAGTATGGGAGAGGGTAGTGGAATTTCCGGTGTAGCGGTGAAATGCGTAGAGATCG;

[0048] (2) GL261F and LP-A 628 The nucleotide sequence amplified by the R primer ...

Embodiment 3

[0052] Embodiment 3, the method for rapid detection and typing of Legionella

[0053] 1) Use the bacterial genomic DNA extraction solution to extract the bacterial genomic DNA in the specimen to be tested: select the specimen for pretreatment, and then use the bacterial genomic DNA extraction solution to extract the bacterial genomic DNA, wherein the composition of the DNA extraction solution is as follows:

[0054]

[0055] 2) Using bacterial genomic DNA as a template, PCR amplification was carried out using the Legionella specific primers described in Example 1 and the Legionella pneumophila 16s rRNA gene single nucleotide polymorphism site-specific primers; the PCR reaction The mixture consists of the following components: 2×PCR reaction mixture (2×EasyTaq PCR SuperMix, containing 0.1 U Taq Polymerase / µl, 500µM dNTP, 20 mM Tris-HCl (pH8.3), 100 mM KCl, 3 mM MgCl 2 ) 12.5 μL, ddH 2 O 5.5 μL.

[0056] 3) Perform PCR amplification on the positive control and negative cont...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of detection of microbial molecules, and particularly relates to a reagent kit for quickly detecting and typing legionella and a method for detecting the same. The reagent kit for quickly detecting and typing the legionella comprises bacterial genome DNA (deoxyribonucleic acid) extract liquid, PCR (polymerase chain reaction) liquid, PCR primer mixed liquid, positive control liquid and negative control liquid. The PCR primer mixed liquid, the positive control liquid and the negative control liquid contain legionella specific primers and specific primers on polymorphic sites of mononucleotide of 16s rRNA (ribosoma ribonucleic acid) genes of legionella pneumophila. The reagent kit and the method have the advantages that the reagent kit is high in specificity and accuracy, whether the legionella is available or not can be quickly detected by the aid of the reagent kit, whether the legionella is the legionella pneumophila or not further can be simultaneously identified without repeated gel electrophoresis analysis, accordingly, the cost can be saved, and the reagent kit is easy and convenient to operate; accurate detection results can be obtained, and the reagent kit is a perfect reagent kit for quickly detecting and typing the legionella.

Description

technical field [0001] The invention belongs to the field of microbial molecular detection, in particular to a rapid detection and typing kit for legionella and a detection method thereof. Background technique [0002] Legionella is an intracellular gram-negative bacillus that is ubiquitous in soil and water systems. At present, there are 52 species of Legionella including more than 70 serotypes, and new strains are constantly isolated from the environment. In recent years, it has been found that about half of Legionella species are related to human diseases, and more than 80% of Legionella infections are caused by Legionella pneumophila. Legionella infects people in the form of aerosols through the air, causing Legionella pneumonia, which seriously threatens human health. Therefore, it is of great clinical significance to establish a method that can detect Legionella and rapidly distinguish Legionella pneumophila from non-pneumophila Legionella. [0003] At present, the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/01
CPCC12Q1/6858C12Q1/689C12Q2531/113C12Q2565/125
Inventor 朱庆义詹晓勇胡朝晖梁耀铭
Owner GUANGZHOU KINGMED DIAGNOSTICS CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap