A kind of legionella rapid detection and typing kit and its detection method
A Legionella and kit technology, which is applied in the Legionella rapid detection and typing kit and its detection field, can solve the problems of complex result judgment, cumbersome operation, and low accuracy of detection results, and achieve simple operation and accurate detection results , the effect of improving the detection efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1, primer
[0038] The invention provides a primer for rapid detection and typing of legionella.
[0039] Table 1 Primers provided by the present invention
[0040]
Embodiment 2
[0041] Embodiment 2, the pairing of primer and its amplified fragment size
[0042] The Legionella pneumophila 16s rRNA gene single nucleotide polymorphism site-specific primers provided by the present invention are respectively paired with Legionella specific primers to amplify a sequence within 261bp; GL261F-(LPA 628 R) The amplified fragment of the primer pair is 203bp; (LP-C 629 F) The amplified sequence of -GL261R primer pair is 97bp.
[0043] Table 2 The pairing of primers and the size of their amplified fragments
[0044]
[0045] in:
[0046] (1) The nucleotide sequence amplified by GL261F and GL261R primers is:
[0047] GGAGGGTTGATAGGTTAAGAGCTGATTAACTGGACGTTACCCACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTGATTAAGTTATCTGTGAAATTCCTGGGCTTAACCTGGGACGGTCAGATAATACTGGTTGACTCGAGTATGGGAGAGGGTAGTGGAATTTCCGGTGTAGCGGTGAAATGCGTAGAGATCG;
[0048] (2) GL261F and LP-A 628 The nucleotide sequence amplified by the R primer ...
Embodiment 3
[0052] Embodiment 3, the method for rapid detection and typing of Legionella
[0053] 1) Use the bacterial genomic DNA extraction solution to extract the bacterial genomic DNA in the specimen to be tested: select the specimen for pretreatment, and then use the bacterial genomic DNA extraction solution to extract the bacterial genomic DNA, wherein the composition of the DNA extraction solution is as follows:
[0054]
[0055] 2) Using bacterial genomic DNA as a template, PCR amplification was carried out using the Legionella specific primers described in Example 1 and the Legionella pneumophila 16s rRNA gene single nucleotide polymorphism site-specific primers; the PCR reaction The mixture consists of the following components: 2×PCR reaction mixture (2×EasyTaq PCR SuperMix, containing 0.1 U Taq Polymerase / µl, 500µM dNTP, 20 mM Tris-HCl (pH8.3), 100 mM KCl, 3 mM MgCl 2 ) 12.5 μL, ddH 2 O 5.5 μL.
[0056] 3) Perform PCR amplification on the positive control and negative cont...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



