snp markers and their applications
A marker and goat technology, applied in the direction of recombinant DNA technology, DNA/RNA fragments, microbial determination/inspection, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Acquisition of SNP markers associated with goat wool curl
[0039] The inventors used RAD-seq and genome-wide association analysis (GWAS) to mine green goat wool curl-related genetic markers, and using these markers can improve the accuracy of wool curl trait selection. Specific steps are as follows:
[0040] 1. Collection of blood samples and DNA extraction of green goats
[0041] 1) 457 blood samples were collected from green goats of Shandong Yongwang Animal Husbandry Development Co., Ltd., and the statistics of wool curl characteristics are shown in Table 1.
[0042] 2) Genomic DNA was extracted by the phenol-chloroform method.
[0043] Table 1 Statistical results of curly properties of green goat wool
[0044] character
straight hair
total
number of individuals
431
26
457
[0045] 2. RAD-seq library construction
[0046] Library construction method reference (Rapid SNP Discovery and Genetic Mapping...
Embodiment 2
[0064] Example 2 Sequencing verification of SNP markers associated with goat wool curls
[0065] 2.1 Extract the genomic DNA in the blood sample of the green goat to be tested
[0066] The blood samples of the green goats to be tested were from the green goats of Shandong Hanlong Goat Industry Co., Ltd., 5 samples were randomly selected, and the genomic DNA was extracted according to the DNA extraction method described in Example 1.
[0067] 2.2 Amplification of nucleotide fragments containing SNP sites
[0068] Using the genomic DNA in the blood samples of the green goats to be tested obtained by the aforementioned extraction as a template, using the forward primer F: CAAGGTTTAACAAGGCAGTT (SEQ ID NO: 2) and the reverse primer R: CTGTTGATCCAAGTGAACTT (SEQ ID NO: 3), amplified The nucleotide fragment where the SNP to be tested is located. The amplification system of this PCR amplification is calculated as 20 μl: 2 μl of template DNA of 25-50 ng / μl, 0.3 μl of each primer shown...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


