LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1C of transgenic plants
The technology of a transgenic plant and a detection kit, which is applied in the field of molecular biology, can solve problems such as detection methods and kits for the cry1C gene in transgenic plants that have not yet been detected, and achieve the effect of simple operation and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Embodiment 1 kit and detection method thereof.
[0037] Prepared according to the following recipe cry1C Gene LAMP detection kit, each kit has a specification of 100 reactions:
[0038] (1) Detection primer solution: Synthesize outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LB, and make primer dry powder into mother solutions with a concentration of 100 μmol / L with ultrapure water, Then take 5 μL of outer primer F3, 5 μL of outer primer B3, 40 μL of inner primer FIP, 40 μL of inner primer BIP, 5 μL of loop primer LF, and 5 μL of loop primer LB, put them into a new 1.5mL centrifuge tube, mix well, and prepare 100 μL cry1C Gene LAMP detection primer solution, wherein the primer sequences are:
[0039] Outer primer F3: CTTTAGGATCTCTGGATTTGAAG (SEQ ID NO: 1);
[0040] Outer primer B3: TGTAAGTGTTAGCACAGTGA (SEQ ID NO: 2);
[0041] Internal primer FIP: TCCGAAGATCACAGAATCTCTAAGGTTCCACTTCCTCTCTGTTTACG (SEQ ID NO: 3); ...
Embodiment 2
[0055] Embodiment 2 The specificity experiment of kit and detection method.
[0056] Prepare the kit according to the kit preparation method described in Example 1, and carry out the specificity test for its detection method:
[0057] (1) Extraction of cry1Ie-transgenic maize IE09S034, cry1C-transgenic rice T1c-19, cry1F-transgenic maize TC1507, cry34Ab and cry35Ab-transgenic maize 59122, vip3A-transgenic MIR162, dmo-transgenic soybean MON87708, aad1-transgenic maize DAS40278-9 Genomic DNA of 8 kinds of test materials such as non-transgenic corn and non-transgenic corn, the DNA concentration was measured with ND1000 nucleic acid micrometer, and diluted to 25ng / μL with ultrapure water;
[0058] (2) In the 200 μL eight-tube tube, according to the steps described in Example 1, add 15.5 μL of ultrapure water, 1 μL of detection primer solution, 1 μL of BstDNA polymerase, and 2.5 μL of 10× reaction buffer to each tube in sequence , 3 μL of dNTPs solution, and then add 2 μL of IE09S...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap