Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1C of transgenic plants

The technology of a transgenic plant and a detection kit, which is applied in the field of molecular biology, can solve problems such as detection methods and kits for the cry1C gene in transgenic plants that have not yet been detected, and achieve the effect of simple operation and strong specificity

Inactive Publication Date: 2016-04-13
JILIN ACAD OF AGRI SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no LAMP method has been used to detect transgenic plants. cry1C Gene detection methods and kits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP (Loop-mediated isothermal amplification) detection primer group and kit and detection method for gene cry1C of transgenic plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1 kit and detection method thereof.

[0037] Prepared according to the following recipe cry1C Gene LAMP detection kit, each kit has a specification of 100 reactions:

[0038] (1) Detection primer solution: Synthesize outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF, and loop primer LB, and make primer dry powder into mother solutions with a concentration of 100 μmol / L with ultrapure water, Then take 5 μL of outer primer F3, 5 μL of outer primer B3, 40 μL of inner primer FIP, 40 μL of inner primer BIP, 5 μL of loop primer LF, and 5 μL of loop primer LB, put them into a new 1.5mL centrifuge tube, mix well, and prepare 100 μL cry1C Gene LAMP detection primer solution, wherein the primer sequences are:

[0039] Outer primer F3: CTTTAGGATCTCTGGATTTGAAG (SEQ ID NO: 1);

[0040] Outer primer B3: TGTAAGTGTTAGCACAGTGA (SEQ ID NO: 2);

[0041] Internal primer FIP: TCCGAAGATCACAGAATCTCTAAGGTTCCACTTCCTCTCTGTTTACG (SEQ ID NO: 3); ...

Embodiment 2

[0055] Embodiment 2 The specificity experiment of kit and detection method.

[0056] Prepare the kit according to the kit preparation method described in Example 1, and carry out the specificity test for its detection method:

[0057] (1) Extraction of cry1Ie-transgenic maize IE09S034, cry1C-transgenic rice T1c-19, cry1F-transgenic maize TC1507, cry34Ab and cry35Ab-transgenic maize 59122, vip3A-transgenic MIR162, dmo-transgenic soybean MON87708, aad1-transgenic maize DAS40278-9 Genomic DNA of 8 kinds of test materials such as non-transgenic corn and non-transgenic corn, the DNA concentration was measured with ND1000 nucleic acid micrometer, and diluted to 25ng / μL with ultrapure water;

[0058] (2) In the 200 μL eight-tube tube, according to the steps described in Example 1, add 15.5 μL of ultrapure water, 1 μL of detection primer solution, 1 μL of BstDNA polymerase, and 2.5 μL of 10× reaction buffer to each tube in sequence , 3 μL of dNTPs solution, and then add 2 μL of IE09S...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP (Loop-mediated isothermal amplification) detection primer group and kit and a detection method for a gene cry1C of transgenic plants. The primer group consists of 6 specific primers and has nucleotide sequences shown in SEQ ID NO: 1-6. The detection kit comprises a detection primer solution, DNA polymerase with strand displacement activity, a 10x reaction buffer, a dNTPs solution and a color developing agent. The detection method comprises the steps of carrying out amplification on a DNA template of a sample at the temperature of 63-65 DEG C by adopting the specific primers and the DNA polymerase with strand displacement activity, and judging whether the sample contains a gene cry1C component or not by adopting a color developing agent added color change observing method. The detection primer group and kit and the detection method do not need special instruments, have the characteristics of rapidness, high efficiency, simplicity and convenience in operation, high specificity and the like and are applicable to field detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a method for detecting transgenic plants and their products, in particular to a rapid detection method for transgenic plants using loop-mediated isothermal amplification technology (LAMP). cry1C Primer sets, kits and assays for genes. Background technique [0002] In 2014, the global planting area of ​​genetically modified crops reached 181.5 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. Currently commercially grown genetically modified crops mainly include soybean, corn, cotton, and rapeseed, and the main traits are resistance to insects and herbicides. from Bacillus thuringiensis ( Bacillus thuringiensis , Bt ) insect resistance gene is currently the most widely used insect resistance gene in transgenic plants, including cry1Ab , cry1F, cry1Ie , cry1C , cry34Ab, cry35Ab, vip3A etc. among them cry1C...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q1/6844C12Q2531/119C12Q2537/1376C12Q2563/107
Inventor 李飞武闫伟夏蔚邢珍娟邵改革李葱葱董立明刘娜
Owner JILIN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com