Method for constructing multi-gene expression vector through combination of isocaudarner with Gateway clone technology
An expression vector and gene expression cassette technology, applied in the field of molecular biology, can solve the problems of limited number of expression cassettes, difficult to integrate expression cassette fragments, few types of recombination sites, etc., and achieve the effect of simple and convenient construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1 constructs M-8GWN carrier
[0036] Construct the M-8GWN vector, which contains the M35S sequence and the attL recombination site for the GatewayLR reaction. The construction method is as follows:
[0037] (1) Design sequences M35S, MNOS and MOCS, the structures of M35S, MNOS and MOCS are as follows figure 1 Shown: M35S sequence contains EcoRI restriction site, AsiSI restriction site, 35S promoter, NotI restriction site, SbfI restriction site, HA tag sequence, 35S terminator from 5' end to 3' end in sequence , PacI restriction site, AscI restriction site, EcoRI restriction site. The MNOS sequence contains EcoRI restriction site, AsiSI restriction site, NOS promoter, NotI restriction site, SbfI restriction site, Flag tag sequence, NOS terminator, PacI enzyme from 5' end to 3' end in sequence Cutting site, AscI cutting site, EcoRI cutting site. The MOCS sequence contains EcoRI restriction site, AsiSI restriction site, OCS enhancer, OCS promoter, NotI restr...
Embodiment 2
[0051] Use M35S-8GWN vector, MNOS-8GWN vector and MOCS-8GWN vector to construct plant expression vector AtATG1c / 1b / 1a-303 containing Arabidopsis AtATG1a gene expression cassette, AtATG1b gene expression cassette and AtATG1c gene expression cassette, follow the steps below :
[0052] (1) Extract total RNA from mature leaves of wild-type Arabidopsis thaliana with an RNA extraction kit, and reverse transcribe into cDNA with a reverse transcription kit.
[0053] (2) Using cDNA as a template, the AtATG1a[TAIRID:AT3G61960]CDs sequence, AtATG1b[TAIRID:AT3G53930]CDs sequence and AtATG1c[TAIRID:AT2G37840]CDs sequence were respectively amplified with TransStart high-fidelity enzyme. The upstream and downstream primers used for the amplification of the three genes are AtATG1a-F and AtATG1a-R, AtATG1b-F and AtATG1b-R, AtATG1c-F and AtATG1c-R in sequence. The sequence of the amplification primer pair is:
[0054]AtATG1a-F:GCGGCCGCATGGAGTCGGCACGACTTGTG;
[0055] AtATG1a-R:CCTGCAGGAAGATGA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



