Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing multi-gene expression vector through combination of isocaudarner with Gateway clone technology

An expression vector and gene expression cassette technology, applied in the field of molecular biology, can solve the problems of limited number of expression cassettes, difficult to integrate expression cassette fragments, few types of recombination sites, etc., and achieve the effect of simple and convenient construction

Inactive Publication Date: 2016-04-20
CHONGQING UNIV
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the number of expression cassettes that can be assembled by homologous enzymes is not limited, due to the large size of the concatenated expression cassettes, it is not easy to integrate the large concatenated expression cassette fragments into the same large expression vector by enzyme digestion ; and because some genes contain internal recognition sites for the isotailases used, the assembly of these genes is limited
Although the Gateway cloning method can efficiently integrate larger fragments into expression vectors, the number of expression cassettes that can be assembled is limited due to the small number of recombination sites

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing multi-gene expression vector through combination of isocaudarner with Gateway clone technology
  • Method for constructing multi-gene expression vector through combination of isocaudarner with Gateway clone technology
  • Method for constructing multi-gene expression vector through combination of isocaudarner with Gateway clone technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 constructs M-8GWN carrier

[0036] Construct the M-8GWN vector, which contains the M35S sequence and the attL recombination site for the GatewayLR reaction. The construction method is as follows:

[0037] (1) Design sequences M35S, MNOS and MOCS, the structures of M35S, MNOS and MOCS are as follows figure 1 Shown: M35S sequence contains EcoRI restriction site, AsiSI restriction site, 35S promoter, NotI restriction site, SbfI restriction site, HA tag sequence, 35S terminator from 5' end to 3' end in sequence , PacI restriction site, AscI restriction site, EcoRI restriction site. The MNOS sequence contains EcoRI restriction site, AsiSI restriction site, NOS promoter, NotI restriction site, SbfI restriction site, Flag tag sequence, NOS terminator, PacI enzyme from 5' end to 3' end in sequence Cutting site, AscI cutting site, EcoRI cutting site. The MOCS sequence contains EcoRI restriction site, AsiSI restriction site, OCS enhancer, OCS promoter, NotI restr...

Embodiment 2

[0051] Use M35S-8GWN vector, MNOS-8GWN vector and MOCS-8GWN vector to construct plant expression vector AtATG1c / 1b / 1a-303 containing Arabidopsis AtATG1a gene expression cassette, AtATG1b gene expression cassette and AtATG1c gene expression cassette, follow the steps below :

[0052] (1) Extract total RNA from mature leaves of wild-type Arabidopsis thaliana with an RNA extraction kit, and reverse transcribe into cDNA with a reverse transcription kit.

[0053] (2) Using cDNA as a template, the AtATG1a[TAIRID:AT3G61960]CDs sequence, AtATG1b[TAIRID:AT3G53930]CDs sequence and AtATG1c[TAIRID:AT2G37840]CDs sequence were respectively amplified with TransStart high-fidelity enzyme. The upstream and downstream primers used for the amplification of the three genes are AtATG1a-F and AtATG1a-R, AtATG1b-F and AtATG1b-R, AtATG1c-F and AtATG1c-R in sequence. The sequence of the amplification primer pair is:

[0054]AtATG1a-F:GCGGCCGCATGGAGTCGGCACGACTTGTG;

[0055] AtATG1a-R:CCTGCAGGAAGATGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a multi-gene expression vector through combination of isocaudarner with a Gateway clone technology. The method comprises steps as follows: (1), an M35S-8GWN vector, an MNOS-8GWN vector and an MOCS-8GWN vector are constructed; (2), target genes are cloned, the genes are assembled to the M35S-8GWN vector, the MNOS-8GWN vector and the MOCS-8GWN vector through Not I and Sbf I respectively, and multiple gene expression cassettes are formed; (3), the multiple gene expression cassettes are connected in series through the isocaudarner AsiS I and Pac I; (4), the multiple gene expression cassettes are connected to the target expression vector through a Gateway LR reaction. The invention further discloses the three entry vectors M35S-8GWN, MNOS-8GWN and MOCS-8GWN used for constructing the multi-gene plant expression vector.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to a method for constructing a multigene expression vector, in particular to a method for constructing a multigene expression vector by combining homologous enzymes with Gateway cloning technology. Background technique [0002] Transgenic technology is widely used in gene function research, genetic improvement and drug production of animals, plants and microorganisms, and is playing an increasingly important role in the scientific field. Transgenic technology can not only introduce the organism's own genes into the organism's genome to achieve overexpression of its own genes; it can also introduce genes from other species or artificially synthesized genes into the organism's genome to realize the expression of foreign genes and the overexpression of its own genes. Interference and knockout etc. At present, transgenic technology is mostly used to genetically transform a single gene. H...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/66C12N15/63C12N15/82
CPCC12N15/66C12N15/63C12N15/8202
Inventor 任茂智王凯冯丽董攀
Owner CHONGQING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com