Unlock instant, AI-driven research and patent intelligence for your innovation.

Quantitative detection method for specifically detecting mature microRNA expression level and kit

A quantitative detection method and expression level technology, applied in the field of molecular biology, can solve the problems of inability to fully compensate for non-specific amplification of primers, difficult to mature microRNA with high specificity, and expensive Taqman probes.

Active Publication Date: 2016-04-20
SHAANXI MYBIOTECH CO LTD
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Some companies introduce Taqman probes based on the Stem-loopPCR method in order to obtain higher amplification specificity, but Taqman probes are expensive and cannot fully compensate for non-specific amplification caused by non-specific primers
In short, the current method is difficult to achieve a convenient detection of mature microRNA with high specificity and high sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quantitative detection method for specifically detecting mature microRNA expression level and kit
  • Quantitative detection method for specifically detecting mature microRNA expression level and kit
  • Quantitative detection method for specifically detecting mature microRNA expression level and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] The expression levels of microRNA-124-5p (MIMAT0004591, miRbase database) in neurons and Hela cells were compared. The specific implementation steps of this test are as follows:

[0049] Reverse transcription process: Use purchased microRNA extraction kits (such as Qiagen, USA) to extract and enrich small RNAs (smallRNAs, including mature microRNAs, pre-microRNAs, sncRNAs, etc.) in neurons and Hela cells. Use purchased (such as U.S. Invitrogen Company) reverse transcription kit, and purchased (such as NEB Company) polyadenosine nucleotide polymerase (poly (A) polymerase) or polyuridine nucleotide polymerase (poly(U) polymerase) mix to reverse small RNAs to cDNA.

[0050] Wherein, the selection mode of polynucleotide polymerase and reverse transcription primer is as follows:

[0051] 1. The sequence of the precursor pre-microRNA of microRNA-124-5p (MI0000443, miRbase database) is as follows:

[0052] AGGCCUCUCUUCUC CGUGUUCACAGCGGACCUUGAU UUAAAUGUCCAUACAAUUAAGGCACGCG...

Embodiment 2

[0081]Comparison of specificities for the amplification of mature microRNAs. While using the method introduced in the present invention to test the expression level of microRNA-124-5p, the currently commonly used Stem-loopPCR method is used as a control. Two methods were used to detect the expression level of microRNA-124-5p in neurons, and the obtained PCR products were electrophoresed simultaneously to test the specificity of the two methods. Use the testing procedure that the present invention introduces as specific embodiment 1. The steps of using stem-loopPCR detection are as follows:

[0082] Reverse transcription process:

[0083] Use the purchased microRNAstem-loop reverse transcription and PCR kit, and reverse-transcribe the enriched small RNA according to the instructions. Concrete reaction system is as shown in table 3:

[0084] table 3

[0085] small RNA

less than 2ug

2x reaction buffer (included in the kit)

10ul

Reverse transcri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quantitative detection method for specifically detecting the mature microRNA expression level and a kit and belongs to the technical field of molecular biology. The quantitative detection method include the following steps that 1, the microRNA of a sample is extracted, and cDNA is obtained under the effects of reverse transcriptase, Poly A polymerase or Poly U polymerase through reverse transcription; 2, an upstream primer only for a mature microRNA sequence is designed according to the mature microRNA sequence and a pre-microRNA sequence, and then real-time quantitative PCR is performed to specifically detect the mature microRNA expression level. The detection process of the quantitative detection method is simple and convenient, a detection result is sensitive and accurate, the quantitative detection method can be effectively used for detecting the expression level of the mature microRNA (mature microRNA, the length is equal to 20-23 basic groups) within a cell or tissue, and the specificity for mature microRNA detection is higher than those of currently and widely used other methods based on the real-time quantitative PCR.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a quantitative detection method and a kit for specifically detecting the expression level of mature microRNA. Background technique [0002] microRNAs (microRNA) is a class of non-coding, endogenous, single-stranded small molecule RNAs with a length of about 20-23 nucleotides. microRNAs are encoded by genomic DNA, and are initially transcribed into pri-microRNAs of several hundred nucleotides in the nucleus, then cut into pre-microRNAs of about 70-90 bases in length by Drosha, and further processed by Dicer in the cytoplasm , eventually forming mature microRNAs. The post-transcriptional gene regulation by mature microRNAs is widely found in the development and metabolism of eukaryotes, including embryonic development, cell apoptosis, proliferation, differentiation, stress response, body metabolism, immune regulation, and the occurrence and development of dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q2521/101C12Q2521/107C12Q2561/113
Inventor 闫亚平崔浪军李科
Owner SHAANXI MYBIOTECH CO LTD