Development and application of specific SNP co-dominant molecular markers in the rice blast resistance gene pi25 gene
A rice blast resistance gene and molecular marker technology, applied in the field of molecular genetics, can solve the problems of long, cumbersome and complex experiments, and achieve the effect of low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Optimization of PCR conditions for marker primers and detection methods of rice blast resistance gene Pi25 specific SNP co-dominant molecular marker
[0036] 1) Biomaterials
[0037] The CC type material is the parent material Gumei 2 containing the Pi25 gene; the GG type material is the parent material 9311 containing the susceptible allele; the CG type material is the F1 generation material obtained by crossing Gumei 2 and 9311.
[0038] 2) Rice DNA extraction and primer synthesis
[0039] The DNA of the above-mentioned materials was extracted by CTAB method, and the primer sequences shown in Table 1 were synthesized, specifically:
[0040] Pi25-PF GGGATCTAGGCAGACAGT
[0041] Pi25-PR CAGAGCAGGAACTTCAGTTG
[0042] Pi25-NFAGCTGTGGCAAGCCTAACAG
[0043] Pi25-NR GATGCAGGATAAAGAATGAA
[0044] 3)PCR
[0045] The PCR reaction system was 15 μL, containing 1.5 μL 10×Buffer, 1.0 μL dNTPs (10 mmol / L), and 4 primers PF, PR, NF and NR were set at 3 different concentration rat...
Embodiment 2
[0050] The application of rice blast resistance gene Pi25 specific molecular marker primers comprises the following steps:
[0051] Amplification of backbone parents commonly used in production:
[0052] 1) Biomaterials
[0053] The parental controls are Gumei 2 (Pi25), 9311 (susceptible allele), the first generation F1 of the cross between Gumei 2 and 9311, and the testing materials are the backbone parents commonly used in production: Mianhui 725, Minghui 63, and Zhonghuaxiang Rice, Nipponbare, Guichao 2, Huanghuazhan, Lemont, B5, HP121, Koshihikari, Super Basmati, Yandao 4, R1128, Peiai 64S, Guangzhan 63S, HD9802S, II-32A, Jin 23A, Tianfeng A, Jufeng 2A, etc. 20, CTAB method to extract the DNA of the above materials.
[0054] 2) PCR
[0055] The PCR reaction system is 15 μL, containing 1.5 μL 10×Buffer, 1.0 μL dNTPs (10 mmol / L), primers Pi25-PF and Pi25-PR 0.2 μM, primers Pi25-NF and Pi25-NR 0.3 μL; Taq enzyme 0.2 μL (5U / μL), 2.0μL template DNA (50ng / μL), and the rest f...
Embodiment 3
[0060] The application of rice blast resistance gene Pi25 specific molecular marker primers comprises the following steps:
[0061] Expansion of the core germplasm of Chinese cultivated rice:
[0062] 4) Biomaterials
[0063] The parental controls were Gumei 2 (Pi25), 9311 (susceptible allele), the first generation F1 of the cross between Gumei 2 and 9311, and the testing materials were 200 micro-core collections of Chinese cultivated rice. The Chinese cultivated rice micro-core collection is the most representative variety selected from more than 60,000 Chinese rice seed resources. 0.3% of the varieties have preserved more than 70% of the marker polymorphisms and phenotypic polymorphisms of all varieties. The CTAB method was used to extract DNA from the above materials.
[0064] 5) PCR
[0065] The PCR system is the same as in Example 2.
[0066] 6) Result analysis
[0067] Using the specific co-dominant marker in the Pi25 gene of the present invention to identify the mi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More