High-efficiency Atrazine degrading bacteria and application and screening method thereof
An atrazine and screening method technology, applied in the field of environmental microorganisms, can solve the problems of difficult biochemical degradation, polluted surface water and groundwater, etc., and achieve the effect of improving economic benefits
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1: The strain of the present invention is screened from the soil of Jilin Chemical Co., Ltd. Pesticide Factory, where atrazine has been applied for a long time, and the screening method is realized in the following steps.
[0030] (1) Take 10g of contaminated soil from the pesticide factory of Jilin Chemical Co., Ltd., add 100ml of inorganic salt medium (pH=8) containing 100mg / L atrazine to a conical flask, and place on a constant temperature shaker at 30°C at 150r / min domestication culture. Take the acclimatization culture medium and inoculate it into fresh inorganic salt medium containing 100mg / L atrazine every 7 days, the inoculum amount is 10% (v / v);
[0031] (2) After 30 days of continuous acclimatization culture, the enriched culture was diluted by 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 and 10 -9 times, take 0.1mL each and spread on 100mg / L atrazine solid plate respectively, and place in a constant temperature incubator at 30°C...
Embodiment 2
[0042] The DNA extraction kit (Sangon) was used to extract bacterial DNA according to the extraction steps, and then the target fragment of PCR was amplified. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, and annealing at 55°C for 1 min. Extend at 72°C for 1.5 min, and then at 72°C for 5 min. PCR amplified products were sent to Dalian Bao Biology Co., Ltd. for sequencing. The strain was identified by 16SrDNA, and its homology was compared by Blast program. The homology between this strain and Arthrobacter TBD185 was 99%. Its sequence is as follows:
[0043] ACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGATGATCCGGTGCTTGCGCCGGGGATTAGTGGCGAACGGGTGAGTAACACGTGAGTAACCTGCCCTTGACTCTGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATATGACTCCTCATCGCATGGTGGGGGGTGGAAAGCTTTTTGTGGTTTTGGATGGACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACGACGGGTAGCCGGCCTGAGAGGGTGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCG...
Embodiment 3
[0045] Pick a 4°C slant to preserve the bacteria Arthrobactersp.ZXY-2 and culture it in 100mg / L atrazine liquid medium until 10 8 For MPN / ml, inoculate the bacterial suspension into fresh inorganic salt liquid medium according to the inoculation amount of 5% (v / v), and place it in a shaking table at 30°C and 150r / min after inoculation. Wherein, the initial pH value of the liquid medium is 8.0. Taking time as the abscissa, the absorbance OD 600 The value is the vertical axis, and the growth curve is drawn. During the period, samples were taken every 1h to measure OD 600 value. bacterial growth curve figure 2 As shown, the bacterium is in the adjustment period within 0h-4h; it enters the logarithmic growth phase from the 4th hour; at the 18th hour, the OD 600 The value is 0.8; when the bacteria continue to grow to the 24th hour, the OD 600 The value is 1.0.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com