Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-efficiency Atrazine degrading bacteria and application and screening method thereof

An atrazine and screening method technology, applied in the field of environmental microorganisms, can solve the problems of difficult biochemical degradation, polluted surface water and groundwater, etc., and achieve the effect of improving economic benefits

Active Publication Date: 2016-05-11
宜兴环保产业有限公司
View PDF1 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, due to people's unreasonable use of pesticides and the refractory biodegradability of pesticides, pesticides often flow into rivers and soil along with precipitation, seriously polluting surface water and groundwater

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-efficiency Atrazine degrading bacteria and application and screening method thereof
  • High-efficiency Atrazine degrading bacteria and application and screening method thereof
  • High-efficiency Atrazine degrading bacteria and application and screening method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1: The strain of the present invention is screened from the soil of Jilin Chemical Co., Ltd. Pesticide Factory, where atrazine has been applied for a long time, and the screening method is realized in the following steps.

[0030] (1) Take 10g of contaminated soil from the pesticide factory of Jilin Chemical Co., Ltd., add 100ml of inorganic salt medium (pH=8) containing 100mg / L atrazine to a conical flask, and place on a constant temperature shaker at 30°C at 150r / min domestication culture. Take the acclimatization culture medium and inoculate it into fresh inorganic salt medium containing 100mg / L atrazine every 7 days, the inoculum amount is 10% (v / v);

[0031] (2) After 30 days of continuous acclimatization culture, the enriched culture was diluted by 10 -1 、10 -2 、10 -3 、10 -4 、10 -5 、10 -6 、10 -7 、10 -8 and 10 -9 times, take 0.1mL each and spread on 100mg / L atrazine solid plate respectively, and place in a constant temperature incubator at 30°C...

Embodiment 2

[0042] The DNA extraction kit (Sangon) was used to extract bacterial DNA according to the extraction steps, and then the target fragment of PCR was amplified. The PCR reaction conditions were: pre-denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, and annealing at 55°C for 1 min. Extend at 72°C for 1.5 min, and then at 72°C for 5 min. PCR amplified products were sent to Dalian Bao Biology Co., Ltd. for sequencing. The strain was identified by 16SrDNA, and its homology was compared by Blast program. The homology between this strain and Arthrobacter TBD185 was 99%. Its sequence is as follows:

[0043] ACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGATGATCCGGTGCTTGCGCCGGGGATTAGTGGCGAACGGGTGAGTAACACGTGAGTAACCTGCCCTTGACTCTGGGATAAGCCTGGGAAACTGGGTCTAATACCGGATATGACTCCTCATCGCATGGTGGGGGGTGGAAAGCTTTTTGTGGTTTTGGATGGACTCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAAGGCGACGACGGGTAGCCGGCCTGAGAGGGTGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCG...

Embodiment 3

[0045] Pick a 4°C slant to preserve the bacteria Arthrobactersp.ZXY-2 and culture it in 100mg / L atrazine liquid medium until 10 8 For MPN / ml, inoculate the bacterial suspension into fresh inorganic salt liquid medium according to the inoculation amount of 5% (v / v), and place it in a shaking table at 30°C and 150r / min after inoculation. Wherein, the initial pH value of the liquid medium is 8.0. Taking time as the abscissa, the absorbance OD 600 The value is the vertical axis, and the growth curve is drawn. During the period, samples were taken every 1h to measure OD 600 value. bacterial growth curve figure 2 As shown, the bacterium is in the adjustment period within 0h-4h; it enters the logarithmic growth phase from the 4th hour; at the 18th hour, the OD 600 The value is 0.8; when the bacteria continue to grow to the 24th hour, the OD 600 The value is 1.0.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to high-efficiency Atrazine degrading bacteria and an application and screening method thereof. The bacteria are ZXY-2, belong to Arthrobacter, are preserved in China General Microbiological Culture Collection Center and have the preservation number of CGMCC No.10937 and the preservation date of July 1st, 2015. The bacteria can grow with Atrazine as the unique carbon and nitrogen source, and Atrazine with the initial concentration of 100 mg / L can be completely degraded within 14 hours. The strain Arthrobacter sp. ZXY-2 has the optimal growth temperature of 30 DEG C to 35 DEG C, the optimal growth pH of 8.0 to 9.0 and the optimal growth table rotating speed of 100 r / min to 200 r / min. The bacteria can be used for rapidly repairing the pollution of Atrazine pesticide.

Description

technical field [0001] The invention relates to the technical field of environmental microorganisms, in particular to a bacterium for degrading atrazine, a screening method and an application thereof. Background technique [0002] As a large agricultural country in my country, the amount of pesticide application is increasing year by year. In recent years, due to the unreasonable use of pesticides and the refractory biodegradability of pesticides, pesticides often flow into rivers and soil along with precipitation, seriously polluting surface water and groundwater. Atrazine, as an important herbicide in the northern region, has caused serious harm to animals and plants in nature due to its wide application. How to efficiently degrade atrazine in sewage is a hot issue in the field of water pollution treatment. In order to obtain a stable and efficient degradation effect, the use of microbial remediation technology to decompose atrazine into non-toxic or low-toxic substances...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C02F3/34C12R1/06C02F101/38
CPCC02F3/34C02F2101/38C12N1/205C12R2001/06
Inventor 马放赵昕悦王立杨基先
Owner 宜兴环保产业有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com