A kind of multigene recombinant chimeric antigen receptor molecule
A chimeric antigen receptor, multi-gene technology, applied in the field of molecular biology, to achieve the effect of prolonging the viability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of Common CAR Structure Transmembrane and Intracellular Signal Peptide Fragments
[0042] The gene carrier is the eukaryotic fluorescent expression plasmid pIres2-EGFP. Select CD28 transmembrane and intracellular fragments (UniProtKB: P10747-1, 340nt-660nt) and CD3zeta fragments (UniProtKB: P20963-1, 154nt-495nt), and design 5'BglII and 3'SalI restriction sites at both ends, Among them, the CD28 intracellular co-stimulatory sequence AGGCTCCTG was changed to CGCGGAGGA according to literature records (Blood. 2003; 102:4320-4325), and the encoded amino acid was changed from double leucine to double glycine. The sequence is marked as 28ZT, and the sequence is as follows:
[0043] AGATCT ATTGAAGTTATGTATCCTCCTCCTTACCTAGACAATGAGAAGAGCAATGGAACCATTATCCATGTGAAAGGGAAACACCTTTGTCCAAGTCCCCTATTTCCCGGACCTTCTAAGCCCTTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTATTTTCTGGGTGAGGAGTAAGAGGAGCCGCGGAGGACACAGTGACTACATGAACATGACTCCCCGCCGCCCCGGGCCCAC...
Embodiment 2
[0045] Example 2 Construction of PD-1 (PDCD1) transmembrane and intracellular signal peptide fragments
[0046] Starting from the 5' end Bgl II, design a Kozak sequence (GCCACC), the start codon ATG and the nucleic acid sequence encoding a connecting peptide of 15 amino acids. The 3'downstream of the connecting peptide nucleic acid sequence is sequentially connected: PD-1 (UniProtKB: Q15116, 61nt-588nt), CD28 (UniProtKB: P10747-1, 538nt-660nt), CD3zeta (UniProtKB: P20963-1, 154nt-495nt), and finally is the sequence of the Sal I restriction site. The sequence is marked as PD-1-28ZT, and the sequence is as follows:
[0047] AGATCTGCCACCATGGGTGGCGGTGGCTCGGGCGGTGGTGGCTCCGGCGGTGGCGGTTCGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCA...
Embodiment 3
[0049] Example 3 Construction of PD-L1 transmembrane and intracellular signal peptide fragments
[0050] Starting from the 5' end Bgl II, design a Kozak sequence (GCCACC), the start codon ATG and the nucleic acid sequence encoding a connecting peptide of 15 amino acids. The 3'downstream of the connecting peptide nucleic acid sequence is sequentially connected: PD-L1 (UniProtKB: Q9NZQ7, 55nt-792nt), CD28 (UniProtKB: P10747-1, 538nt-660nt), CD3zeta (UniProtKB: P20963-1, 154nt-495nt), and finally is the sequence of the Sal I restriction site. The sequence is marked as PD-L1-28ZT, and the sequence is as follows:
[0051] AGATCT GCCACCATGGGTGGCGGTGGCTCGGGCGGTGGTGGCTCCGGCGGTGGCGGTTCGTTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGG...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



