Supercharge Your Innovation With Domain-Expert AI Agents!

A high-efficiency plasmid system for allele integration of Saccharomyces cerevisiae and its application

An allele, Saccharomyces cerevisiae technology, applied in the direction of using vectors to introduce foreign genetic material, microorganisms, nucleic acid vectors, etc., to achieve a wide range of applications, high-throughput allele integration, and improvement of yeast gene function related research technology effects

Inactive Publication Date: 2019-07-23
DONGHUA UNIV +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But the technology requires some key components - an integration cassette, which has half of the KanMX module at the 5' and 3' ends, flanking sequences containing the target gene (AOI) in the middle and URA3 as a selection marker

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A high-efficiency plasmid system for allele integration of Saccharomyces cerevisiae and its application
  • A high-efficiency plasmid system for allele integration of Saccharomyces cerevisiae and its application
  • A high-efficiency plasmid system for allele integration of Saccharomyces cerevisiae and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Construction of plasmid pDH735.

[0035] 1. Design primers

[0036] EM7-F: TCTCACATCACATCCGAACATAAACAACCATGGTCAGTCTAGATGTTGACAATTAATCATCGGC

[0037] EM7-R: TGCACTTCTCAGTACAATCTGGTTTAG TTCCTCACCTTGTC

[0038] TRP1-F:GACAAGGTGAGGAACTAAACC AGATTGTACTGAGAGTGCA

[0039] TRP1-R: CCTCGAAACGTGAGTCTTTTTCCTTACCCATACTCCAAGCTGCCTTTGTGT

[0040] ATTP1-F: CATGCCATGGCTCGAGCAAATAATGATTTTATTTTGACTGA

[0041] ATTP1-R:GCGTGGATCCGGCTTACTA

[0042] ATTP2-F:TAGTAAGCCGGATCCACGC

[0043] ATTP2-R:GCTCTAGACAATTGCAAATAATGATTTTATTTTGACTGA

[0044] 2. Using yeast genomic DNA as a template and EM7-F and EM7-R as amplification primers, use a conventional PCR system and reaction program for PCR amplification to obtain the PCR product of the EM7 promoter. Similarly, the PCR product of the TRP1 promoter was amplified by using yeast genomic DNA as a template and TRP1-F and TRP1-R as amplification primers. Then the PCR products of EM7 promoter and TRP1 promoter were purified and recovered.

[004...

Embodiment 2

[0049] Construction of plasmid pDH818.

[0050] 1. Design primers

[0051] PT-F:GAATTCTCGAGCCTAGGACTGTCAAGGAGGGTATTC

[0052] PT-R:GAATTCTCGAGTAAGGAAAAGACTCACGTTTC

[0053] 2. Using the plasmid pFA6a-kanMX as a template, PT-F and PT-R as amplification primers, use conventional PCR system and reaction procedures to perform PCR amplification to obtain the PCR product of pFA6a-kanMX, and then purify and recover the PCR product.

[0054] 3. The purified PCR product of pFA6a-kanMX is digested with XhoI, and the digested product is further purified and recovered.

[0055] 4. The purified digested product was self-ligated under the action of T4 ligase, and the correct plasmid was obtained after screening with kanamycin, and the obtained plasmid was named pDH817.

[0056] 5. Carry out XhoI / SacI double digestion of plasmids pDH735 and pDH817 to obtain the attP1-ccdB-CAT-attP2-pTRP1 cassette and linearized pDH817. The digested products are purified and catalyzed by T4 ligase, and the...

Embodiment 3

[0058] Construction of plasmid pDH824.

[0059] 1. Design primers

[0060] ADH1-F:

[0061] TTCTCACATCACATCCGAACATAAACAACCATGGTCAGTCTAGACTTGATAGCCATCATCATATC

[0062] ADH1-R: GTAAGCCGTGTCGTCAAGAGTGGTACCCATTGTATATGAGATAGTTGATTG

[0063] 2. Using yeast genomic DNA as a template, ADH1-F and ADH1-R as amplification primers, clone the ADH1 promoter into pAG25 according to the method in Example 1, construct the pTEF-pADH1-nat-tTEF cassette, and obtain the plasmid Named pDH823.

[0064] 3. Perform AscI / XbaI double enzyme digestion on the pDH735 plasmid to obtain the attP1-ccdB-CAT-attP2 cassette, and subclone the attP1-ccdB-CAT-attP2 cassette into the plasmid pDH823 according to the method in Example 3 to construct pTEF-attP1 -ccdB-CAT-attP2-pADH1-nat-tTEF integration cassette, the obtained plasmid is pDH824, the full length is 6629bp.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an efficient saccharomyces cerevisiae allele integration plasmid system and application thereof. The system comprises four types of saccharomyces cerevisiae allele integration plasmids, namely, pDH735, pDH818, pDH824 and pDH825. The system is applied to efficient saccharomyces cerevisiae allele integration. An integration method includes the steps that the four types of saccharomyces cerevisiae allele integration plasmids based on different cartridges for saccharomyces cerevisiae allele integration are constructed; a target gene to be studied and flanks thereof are cloned into the integration cartridges of the plasmids; the integration cartridges are released or amplified out and transferred into a saccharomyces cerevisiae strain of a gene knockout background or a non-gene knockout background, and integration effect screening and identifying are carried out. The allele integration method is efficient, convenient and fast, high in throughput, wider in application range and particularly suitable for rapid and high-throughput saccharomyces cerevisiae genome allele integration.

Description

technical field [0001] The invention belongs to the technical field of yeast allele integration in the field of genetics, and in particular relates to a high-efficiency integration plasmid system of Saccharomyces cerevisiae alleles and its application. Background technique [0002] With the advancement of mass spectrometry (mass spectrometry), we can use mass spectrometry to quickly and high-throughput identify gene transcription and modification. However, functional analysis of genes requires phenotypic identification of unmodified and / or simulated modified allelic mutants. For S. cerevisiae, such alleles can be analyzed by centromeric plasmids carrying the corresponding deletion or conditional alleles. However, to avoid potential problems arising from copy number and / or activation of faulty transcriptional regulation when a plasmid carries an allele, it is sometimes more appropriate to express the integrated allele from the original locus. [0003] Several methods for in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81
CPCC12N15/81C12N2800/102C12N2800/60
Inventor 黄志伟房志家沈裕虎孟晓卿魏红岩
Owner DONGHUA UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com