Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of Signal Recognition Particle Subunit and Its Encoding Gene in Producing Acid-resistant Bifidobacterium and Plasmid and Bifidobacterium Containing the Gene

A bifidobacterium and signal recognition technology, applied in the field of genetic engineering, can solve the problems of unstable genetic characteristics of bifidobacteria, cumbersome operation, and poor taste

Active Publication Date: 2019-06-04
BEIJING UNIV OF AGRI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the coating process is cumbersome, and the taste of yogurt or lactic acid beverages added with coated strains will deteriorate, and the genetic characteristics of acid-resistant and domesticated bifidobacteria are also relatively unstable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Signal Recognition Particle Subunit and Its Encoding Gene in Producing Acid-resistant Bifidobacterium and Plasmid and Bifidobacterium Containing the Gene
  • Application of Signal Recognition Particle Subunit and Its Encoding Gene in Producing Acid-resistant Bifidobacterium and Plasmid and Bifidobacterium Containing the Gene
  • Application of Signal Recognition Particle Subunit and Its Encoding Gene in Producing Acid-resistant Bifidobacterium and Plasmid and Bifidobacterium Containing the Gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] 1. Recombinant expression plasmid P 18 Construction of P-Ffh

[0049] (1) Construction of expression plasmid P 18 P

[0050] The pDG-7 plasmid and pUC18 plasmid were double-digested with BamH I and Hind III, respectively, and the pMB1 of the pDG-7 digestion product was recovered, and the pUC18 digestion product was recovered, and the 10- After 12 hours, transfer the plasmid into DH5α Escherichia coli competent cells by heat shock, plate on LB solid medium containing 100 μg / mL ampicillin and culture for 16 hours, pick a single colony and culture in LB liquid medium containing 100 μg / mL ampicillin Extracted after enrichment in the base to obtain a 4758bp plasmid P 18 P( Figure 1B ).

[0051] (2) Preparation of gene encoding signal recognition particle subunit

[0052] Use the upstream primer (Primer F:CG as shown in SEQ ID No: 4 GAATTC CTTGACAGACAGACTCTCGAATGCGT, the underline is the EcoRI restriction site) and the downstream primer shown in SEQ ID No: 5 (Primer ...

Embodiment 2

[0079] Each step was carried out according to the method of Example 1, except that the bifidobacterium used was Bifidobacterium juvenile CGMCC No.6270.

[0080] The results show that the conversion has P 18 The survival rates of this strain of P-Ffh at pH 1, 2 and 3.5 were 2%, 5% and 8%, respectively, and the survival rates of normal strains at pH 1, 2 and 3.5 were 0.1%, 0.7% and 1.5 %.

Embodiment 3

[0082] Carry out each step according to the method of embodiment 1, difference is, the plasmid used is not P 18 P, but the pMG36e plasmid.

[0083] The results showed that the expression level of this plasmid in CGMCC No.2265 was extremely low, and it could only be faintly visible in agarose electrophoresis, and the survival rates of CGMCC No.2265 transformed with this plasmid in pH 1, 2 and 3.5 were respectively 3%, 5% and 7%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Bronsted acidityaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of bioengineering, particularly discloses a signal recognition particle subunit shown in SEQ ID No:1 and / or application of a nucleotide sequence encoding the signal recognition particle subunit to preparation of acid-resistant bifidobacterium, and further discloses a recombinant expression plasmid containing the nucleotide sequence and the acid-resistant bifidobacterium containing the signal recognition particle subunit and / or the nucleotide sequence encoding the signal recognition particle subunit and / or the acid-resistant bifidobacterium of the recombinant expression plasmid. According to the technical scheme, a gene encoding the signal recognition particle subunit shown in SEQ ID No:1, preferentially a plasmid P18P containing the gene is converted into bifidobacterium which is preferred as bifidobacterium CGMCCNo.2265, and the gene can resistant to acid with the pH being 1, the preferential pH being 2 and the optimal pH being 3.5.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to the application of the signal recognition particle subunit shown in SEQ ID No: 1 and / or the nucleotide sequence encoding the signal recognition particle subunit in the preparation of acid-resistant bifidobacteria, and containing The recombinant expression plasmid of the nucleotide sequence and acid-resistant bifidobacterium. Background technique [0002] Bifidobacteria are the most beneficial flora in the intestine, and the suitable pH value for growth is 6.5-7.5. The reduction or even disappearance of the number of bifidobacteria is a sign of an "unhealthy" state. Bifidobacteria are a barometer of human health. The main way to replenish bifidobacteria is to drink yogurt or beverages containing bifidobacteria, or directly drink the probiotics of bifidobacteria (bacteria powder or 1:3 serving liquid). [0003] It is known that the acidity of human gastric juice is gener...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/31C12N15/74C12R1/01
CPCC07K14/195C12N15/74C12N2800/101
Inventor 金君华任发政王芳张红星刘慧马京升龚煜欣李雪
Owner BEIJING UNIV OF AGRI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More