A common wheat high thousand-grain weight gene and its application
A thousand-grain weight and wheat technology, applied to common wheat high thousand-grain weight gene (TaGS5-A1b-b) and its application fields, can solve the problem of no polymorphism found in the coding region and promoter region, achieve early screening and save time and resource effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1 Investigation of Characters of Different Varieties of Wheat
[0027] The inventor conducted field investigations on 166 representative local large-scale planted common wheat varieties and advanced lines from April to June every year in the Huanghuai wheat region from 2013 to 2015. The thousand-grain weight data of each variety is shown in Table 1.
[0028] Table 1 Survey table of traits of different varieties of wheat
[0029]
[0030] Table 1 Continued 1 Survey of traits of different varieties of wheat
[0031]
[0032] Table 1 Continued 2 Survey of traits of different varieties of wheat
[0033]
[0034] Table 1 Continued 3 The traits survey of different varieties of wheat
[0035]
[0036] Table 1 Continued 4 Survey Form of Characters of Different Wheat Varieties
[0037] .
Embodiment 2
[0038] Example 2 Identification with specific primers TaGS5-A1b-b genotype wheat
[0039] The test materials were 4 wheat varieties: Neixiang 184, Jimai 20, Gaocheng 9411, and Yumai 9. One seed was taken from each variety of wheat, and the genomic DNA of wheat grain was extracted according to the conventional method (Chen et al., 2011) as Template, PCR amplification with specific primers.
[0040] Specific primer pairs are as follows:
[0041] Upstream primer: 5'- TCATACACACATAATCCAGTCGA -3' (SEQ ID NO.3);
[0042] Downstream primer: 5'-GATCGTGGGTGTTGCATCTAT-3' (SEQ ID NO.4).
[0043] Composition of PCR reaction system: 1.5mmol / L MgCl 2 , 0.3mmol / L dNTP, 10pmol of upstream and downstream primers, 200ng of template DNA, 0.5U Taq Enzyme, add 1×PCR buffer (containing 10 mmol / L Tris-HCl, pH 9.0, 50 mmol / L KCl, 1.0% Triton X-100) to 25 µL.
[0044] PCR reaction program: 95°C pre-denaturation for 5 min; then denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension a...
Embodiment 3
[0048] Fengkang 13, Space 6, Pumai 9, and Neijiang 31 were detected by the same method as in Case 2, and the results showed that the amplified products of Fengkang 13, Pumai 9, and Neijiang 31 were sequenced in TaGS5-A1b When there is no G insertion at the -1925bp position on the gene promoter, it is not TaGS5-A1b-b Genotype wheat; when there is a single base G insertion at the -1925bp position upstream of the gene promoter after sequencing the amplified product of Space 6, it is TaGS5-A1b-b genotype wheat. It can be seen from Table 1 that the thousand-grain weight of Tiankong 6 is 50.74 g, while the thousand-grain weight of Fengkang 13, Pumai 9 and Neijiang 31 are 43.88 g, 41.57 g and 32.56 g, respectively, which are the weights of TaGS5-A1b-b genotype wheat. The kernels were larger than those of non-TaGS5-A1b-b genotype wheat, therefore, the detection results were consistent with the investigation results.
PUM
Property | Measurement | Unit |
---|---|---|
weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap