A common wheat high thousand-grain weight gene and its application

A thousand-grain weight and wheat technology, applied to common wheat high thousand-grain weight gene (TaGS5-A1b-b) and its application fields, can solve the problem of no polymorphism found in the coding region and promoter region, achieve early screening and save time and resource effects

Inactive Publication Date: 2019-05-10
HENAN AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

and TaGW2-6D No polymorphisms were found in the coding and promoter regions of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A common wheat high thousand-grain weight gene and its application
  • A common wheat high thousand-grain weight gene and its application
  • A common wheat high thousand-grain weight gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Investigation of Characters of Different Varieties of Wheat

[0027] The inventor conducted field investigations on 166 representative local large-scale planted common wheat varieties and advanced lines from April to June every year in the Huanghuai wheat region from 2013 to 2015. The thousand-grain weight data of each variety is shown in Table 1.

[0028] Table 1 Survey table of traits of different varieties of wheat

[0029]

[0030] Table 1 Continued 1 Survey of traits of different varieties of wheat

[0031]

[0032] Table 1 Continued 2 Survey of traits of different varieties of wheat

[0033]

[0034] Table 1 Continued 3 The traits survey of different varieties of wheat

[0035]

[0036] Table 1 Continued 4 Survey Form of Characters of Different Wheat Varieties

[0037] .

Embodiment 2

[0038] Example 2 Identification with specific primers TaGS5-A1b-b genotype wheat

[0039] The test materials were 4 wheat varieties: Neixiang 184, Jimai 20, Gaocheng 9411, and Yumai 9. One seed was taken from each variety of wheat, and the genomic DNA of wheat grain was extracted according to the conventional method (Chen et al., 2011) as Template, PCR amplification with specific primers.

[0040] Specific primer pairs are as follows:

[0041] Upstream primer: 5'- TCATACACACATAATCCAGTCGA -3' (SEQ ID NO.3);

[0042] Downstream primer: 5'-GATCGTGGGTGTTGCATCTAT-3' (SEQ ID NO.4).

[0043] Composition of PCR reaction system: 1.5mmol / L MgCl 2 , 0.3mmol / L dNTP, 10pmol of upstream and downstream primers, 200ng of template DNA, 0.5U Taq Enzyme, add 1×PCR buffer (containing 10 mmol / L Tris-HCl, pH 9.0, 50 mmol / L KCl, 1.0% Triton X-100) to 25 µL.

[0044] PCR reaction program: 95°C pre-denaturation for 5 min; then denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension a...

Embodiment 3

[0048] Fengkang 13, Space 6, Pumai 9, and Neijiang 31 were detected by the same method as in Case 2, and the results showed that the amplified products of Fengkang 13, Pumai 9, and Neijiang 31 were sequenced in TaGS5-A1b When there is no G insertion at the -1925bp position on the gene promoter, it is not TaGS5-A1b-b Genotype wheat; when there is a single base G insertion at the -1925bp position upstream of the gene promoter after sequencing the amplified product of Space 6, it is TaGS5-A1b-b genotype wheat. It can be seen from Table 1 that the thousand-grain weight of Tiankong 6 is 50.74 g, while the thousand-grain weight of Fengkang 13, Pumai 9 and Neijiang 31 are 43.88 g, 41.57 g and 32.56 g, respectively, which are the weights of TaGS5-A1b-b genotype wheat. The kernels were larger than those of non-TaGS5-A1b-b genotype wheat, therefore, the detection results were consistent with the investigation results.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a high thousand-grain-weight gene of common wheat and application of the high thousand-grain-weight gene. A specific primer pair for detecting TaGS5-A1b-b genotype of wheat is 5'-TCATACACACATAATCCAGTCGA-3' and 5'-GATCGTGGGTGTTGCATCTAT-3'; a genome DNA (Deoxyribose Nucleic Acid) of wheat to be detected is taken as a template, and the primer pair is used to perform PCR (Polymerase Chain Reaction) amplification and then sequencing; if G is inserted into -1925bp position on the upstream of a TaGS5-A1b-b gene promoter, the gene TaGS5-A1b-b exists, and otherwise, the gene TaGS5-A1b-b does not exist. The detection primers disclosed by the invention can be applied to identification of TaGS5-A1b-b genotype wheat, and assists wheat molecular breeding and the like; the detection of TaGS5-A1b-b genotype in the molecular level can be directly realized, and important effects of improving grain sizes, the yield and other agronomic characteristics of the wheat are realized.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a gene controlling the grain size of wheat, in particular to a common wheat high 1000-grain weight gene ( TaGS5-A1b-b ) and its applications. Background technique [0002] Wheat is one of the most important food crops in the world, but with the rapid growth of population, the production of food has gradually been unable to meet the growing needs of human beings. Therefore, the improvement of wheat yield has become the key to solve the food problem. So far, many yield-related QTL loci have been identified from common wheat, such as plant height, panicle length, number of grains per panicle, grain weight per panicle, grain length, grain width and thousand-grain weight. [0003] Due to the large genome (≈17.9 Gb) of common wheat, it is very difficult to clone yield-related genes directly from wheat. Comparative genomics has confirmed the synteny of genes between wheat and other cr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/11C12Q1/6895
CPCC07K14/415C12Q1/6895C12Q2600/13
Inventor陈锋王沙沙崔党群董中东赵磊
OwnerHENAN AGRICULTURAL UNIVERSITY