Unlock instant, AI-driven research and patent intelligence for your innovation.
Nucleic acid slow release adjuvant and preparation and use methods thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A slow-release and adjuvant technology, applied in the field of nucleic acid sustained-release adjuvants and its preparation, can solve the problems of lack of systematic research, achieve functional enhancement, good commercial development prospects, and improve neutralizing antibody titer and immune protection Effect
Inactive Publication Date: 2016-07-13
SHANDONG AGRICULTURAL UNIVERSITY
View PDF7 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
There is still a lack of systematic research on livestock, poultry and other animals
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
[0024] The designed molecular sequence and structure of CpGODNs, including: CpG-I (5'-TCGTCGTTTTGTCGTT-3' whose nucleotide sequence is shown in SeqIDNo:2), CpG-II (5'-TCGTCGTTTTGTCGTTTT-3 'its nucleotide sequence is shown in SeqIDNo: 3), CpG-III (5'-TCCATGACGTTCCTGACGTT-3' its nucleotide sequence is shown in SeqIDNo: 4), CpG-IV (5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' its The nucleotide sequence is shown in SeqIDNo: 1) and the CpG-S1 (5'- TCGTCGTT TTGTCGTTTTGTCGTT-3'), CpG-S2 (5'- TCGTCGTTTTGTCGTT TTGTCGTT-3'), CpG-S3 (5'- TCGTCGTTTTGTCGTTTTGTCGTT -3'). The biosynthetic company was entrusted with the synthesis, and after the synthesis, the conventional ULTRA-PAGE method was used for purification.
Embodiment 2
[0025] The preparation of embodiment 2 nucleic acid sustained-release adjuvants
[0026] The preparation method of the nucleic acid sustained-release adjuvant of the present invention is as follows: No. 7 white oil and Siben 80 are mixed at a volume ratio of 94% and 6%, respectively, and then aluminum stearate is added to the above mixture at a mass ratio of 2%, and heated at 116° C. Autoclave, cool to 50°C, shake vigorously until transparent;
[0027] Afterwards, several CpG-ODN molecules synthesized above were added at 100 μg / mL, mixed in equal volumes, and prepared into an oil emulsion, and the adjuvants were respectively named CpG-I, CpG-II, CpG-III, CpG-IV, CpG-S1, CpG-S2, CpG-S3.
Embodiment 3
[0028] Example 3 Validation of Effect of Nucleic Acid Sustained Release Adjuvant
[0029] Using the CpGODNs nucleic acid slow-release adjuvant obtained in Example 2 (marked as CpG-IV or CpG-S3) and other three different base lengths (CpG-I, CpG-II, CpG-III) of the full sulfur modification The CpGODNs nucleic acid sustained-release adjuvant was tested for comparison.
[0030]The above-mentioned nucleic acid adjuvant was used to inoculate 7-day-old Hailan brown chicks with prokaryotically expressed ALV-Jgp85 recombinant protein and AIV-H5 inactivated vaccine, and two booster immunizations were carried out 2 weeks after the first immunization. Collect serum at 1, 2, 3, 4, and 5 weeks after the first immunization, and use IDEXXALV-J antibody detection kit to detect ALV-J serum antibody; at the same time, use indirect hemagglutination inhibition test (HI) to detect AIV-H9 serum antibodytiter ; Slaughter all the chickens at week 5, take the spleen, use the MTT method to detect the...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention relates to the field of biological agents and provides a nucleic acid slow release adjuvant and preparation and use methods thereof.The nucleic acid slow release adjuvant can be used for enhancing the immunoreactivity of animal vaccines.The nucleic acid slow release adjuvant is prepared from total-thio modified 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' nucleic acid molecules; white oil No.7, aluminum stearate and span 80.The preparation method includes the steps that white oil with the volume percentage of 90%, span 80 with the volume percentage of 6% and aluminum stearate with the mass ratio of 2% are mixed, autoclaved sterilization is conducted, the mixture is cooled to 50 DEG C, 100 micrograms / mL nucleic acid molecules are added, and shaking-out and evenly-mixing are conducted.The use method includes the steps that during inoculation, the nucleic acid slow release adjuvant is evenly mixed with vaccine antigens in an isovolumetric mode, 1 mL of the mixture is injected to muscles or the positions under skin, inoculation is conducted 2-3 times every other 2-3 weeks, the valence and immune protection force of a neutralizing antibody can be remarkably improved, and good commercialized development prospects are achieved.
Description
technical field [0001] The invention relates to the field of biological preparations, and provides a nucleic acid slow-release adjuvant and its preparation and use methods. Background technique [0002] Traditional immune adjuvants are oil-emulsion adjuvants, which can improve the immunogenicity and immune protection ability of inactivated vaccines and protein antigens, but compared with attenuated vaccines, there is still a big gap, and often fail to meet the needs of clinical production. prevention effect. Some nucleic acid fragments that stimulate innate immune responses, such as CpG-ODN, can replace traditional immune adjuvants, and can further enhance the immunogenicity and immune protection of immune antigens. [0003] CpG-ODN is a synthetic oligodeoxynucleotide (ODN) containing unmethylated cytosineguanine dinucleotide (CpG), which is a mammalian Toll-like receptor 9 (Toll-like receptor9, TLR9) or An agonist of chicken Toll-like receptor 21 (TLR21), which can direc...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More