Unlock instant, AI-driven research and patent intelligence for your innovation.

ZEN (zearalenone) degrading enzyme gene and high-yield strain

A technology of zearalenone and high-yielding strains, applied in the directions of hydrolase, genetic engineering, plant genetic improvement, etc., can solve the problems of increasing the expression of zhd101, low efficiency of degrading ZEN by enzyme solution, etc., and achieves short time required and high sensitivity. High, easy-to-use effects

Active Publication Date: 2016-07-13
HUBEI UNIV
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, at present, the enzyme solution obtained by expressing zhd101 has a relatively low efficiency in degrading ZEN, and there is no report on increasing the expression level of zhd101 in Pichia pastoris through gene optimization, construction of multiple copies, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ZEN (zearalenone) degrading enzyme gene and high-yield strain
  • ZEN (zearalenone) degrading enzyme gene and high-yield strain
  • ZEN (zearalenone) degrading enzyme gene and high-yield strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] 1. Construction of recombinant Pichia pastoris GS115 / pHBM905BDM-zhd

[0064] (1) Amplification of the optimized gene zhd

[0065] The optimized gene sequence zhd was synthesized by Nanjing GenScript Company, and primers were designed to amplify the target gene. The sequence of the optimized gene sequence zhd is shown in SEQ ID NO.1, and the specific sequence is as follows:

[0066] ATGAGAACTAGATCCACTATTTCAACTCCTAATGGTATCACTTGGTACTATGAGCAAGAGGGAACAGGTCCAGATGTCGTTTTGGTTCCAGATGGTTTGGGAGAATGTCAAATGTTTGACTCTTCCGTTTCTCAAATTGCTGCTCAGGGTTTTAGAGTTACTACATTCGATATGCCTGGAATGTCCAGATCAGCTAAGGCTCCACCTGAAACTTACACAGAGGTTACTGCTCAGAAGTTGGCTTCATACGTTATCTCTGTTTTGGATGCTTTGGACATCAAGCATGCTACTGTTTGGGGTTGTTCATCTGGAGCTTCTACAGTTGTTGCTTTGTTGTTGGGTTACCCAGACAGAATTAGAAACGCTATGTGTCATGAATTGCCTACTAAGTTGTTGGATCACTTGTCCAATACAGCTGTTTTGGAGGACGAAGAGATTTCAAAAATCTTGGCTAACGTTATGTTGAATGATGTTTCTGGTGGTTCTGAAGCTTGGCAAGCTATGGGAGACGAGGTTCATGCTAGATTGCACAAGAACTACCCAGTTTGGGCTAGAGGTTATCCTAGAACTATCCCACCTTCTGCTCCAGTTAAGGATTT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a ZEN (zearalenone) degrading enzyme gene and a high-yield strain. The ZEN degrading enzyme gene comprises DNA molecules of (a), (b) or (c), wherein (a) has DNA molecules of a nucleotide sequence shown in SEQ ID NO.1; (b) hybridizes with the nucleotide sequence in (a) under a strict condition and encodes DNA molecules of protein with ZEN degrading enzyme activity; (c) has DNA molecules of a nucleotide sequence with 90% or higher of homology with the nucleotide sequence in (a) or (b). The invention establishes the high-yield strain for producing ZEN degrading enzymes through the sequences and further provides a high-density fermentation method. ZEN degrading enzymes can be subjected to efficient secretion expression through the high-yield strain with the high-density fermentation method, and ZEN can be quickly and efficiently degraded during fermentation.

Description

technical field [0001] The invention belongs to the field of enzyme engineering and fermentation, and in particular relates to a zearalenone degrading enzyme gene and a high-yield bacterial strain, and more specifically relates to a zearalenone degrading enzyme gene codon optimization, zearalenone degradation Construction of enzyme high-yielding strain and high-density fermentation method. Background technique [0002] Zearalenone (Zearalenone, ZEN) is a nonsteroidal estrogenic mycotoxin produced by Fusarium, which was originally isolated from moldy corn by Stob et al. ZEN is widely polluted by grains and their by-products around the world. In natural environments suitable for fungal growth, high levels of ZEN can often be detected in grains such as corn, barley, and wheat. ZEN enters the food chain through contaminated grain, agricultural by-products and feed, and accumulates in humans and animals. ZEN entering the human body and animals causes estrogen syndrome, leading ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12Q1/44C12N15/81C12N1/19C12R1/84
CPCC12N9/16C12N15/815C12N2800/102C12N2800/22C12Q1/44G01N2333/916
Inventor 张桂敏向腊周玉玲马延和
Owner HUBEI UNIV