ZEN (zearalenone) degrading enzyme gene and high-yield strain
A technology of zearalenone and high-yielding strains, applied in the directions of hydrolase, genetic engineering, plant genetic improvement, etc., can solve the problems of increasing the expression of zhd101, low efficiency of degrading ZEN by enzyme solution, etc., and achieves short time required and high sensitivity. High, easy-to-use effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] 1. Construction of recombinant Pichia pastoris GS115 / pHBM905BDM-zhd
[0064] (1) Amplification of the optimized gene zhd
[0065] The optimized gene sequence zhd was synthesized by Nanjing GenScript Company, and primers were designed to amplify the target gene. The sequence of the optimized gene sequence zhd is shown in SEQ ID NO.1, and the specific sequence is as follows:
[0066] ATGAGAACTAGATCCACTATTTCAACTCCTAATGGTATCACTTGGTACTATGAGCAAGAGGGAACAGGTCCAGATGTCGTTTTGGTTCCAGATGGTTTGGGAGAATGTCAAATGTTTGACTCTTCCGTTTCTCAAATTGCTGCTCAGGGTTTTAGAGTTACTACATTCGATATGCCTGGAATGTCCAGATCAGCTAAGGCTCCACCTGAAACTTACACAGAGGTTACTGCTCAGAAGTTGGCTTCATACGTTATCTCTGTTTTGGATGCTTTGGACATCAAGCATGCTACTGTTTGGGGTTGTTCATCTGGAGCTTCTACAGTTGTTGCTTTGTTGTTGGGTTACCCAGACAGAATTAGAAACGCTATGTGTCATGAATTGCCTACTAAGTTGTTGGATCACTTGTCCAATACAGCTGTTTTGGAGGACGAAGAGATTTCAAAAATCTTGGCTAACGTTATGTTGAATGATGTTTCTGGTGGTTCTGAAGCTTGGCAAGCTATGGGAGACGAGGTTCATGCTAGATTGCACAAGAACTACCCAGTTTGGGCTAGAGGTTATCCTAGAACTATCCCACCTTCTGCTCCAGTTAAGGATTT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
