Method for synthesizing (R)-2-hydroxy acid by biological enzyme method

A bio-enzyme method and hydroxy acid technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of unavailable commercial production, high equipment costs, and increased production costs

Active Publication Date: 2016-07-13
ZHEJIANG UNIV OF TECH +1
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] ①Diastereomeric salt crystallization resolution method, the common problem faced is that it is expensive and has certain toxicity, which causes waste of resources and environmental pollution to a certain extent. At present, R-mandelic acid produced on a large scale in my country uses The method produces
[0009] ② Chromatographic separation method, the equipment cost of this method is too high, the consumption is large, the cost is too high, and the processing capacity is small, so it is limited to detection and laboratory preparation, and cannot be used for commercial production
[0011] ④The capillary electrophoresis separation method is widely used in the separation of various drug enantiomers due to its high efficiency, rapidity, and economy. This method has disadvantages such as high cost
[0013] ① Enzymatic resolution, enzymatic resolution is a kind of kinetic resolution method, the most commonly used is to degrade one enantiomer in the racemate, leaving another configuration to achieve resolution Purpose, since this method obtains the desired enantiomer by selectively degrading one of the configurations, the conversion rate is limited and cannot exceed 50%, which has certain limitations
The advantage of this method is high theoretical yield, simple operation, etc. The disadvantage is that the reaction process generally requires the addition of coenzyme, which is expensive and greatly increases production costs, which is not conducive to industrial applications.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for synthesizing (R)-2-hydroxy acid by biological enzyme method
  • Method for synthesizing (R)-2-hydroxy acid by biological enzyme method
  • Method for synthesizing (R)-2-hydroxy acid by biological enzyme method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] Construction of recombinant strain E.coliBL21(DE3) / pET28b-HADH1 / pCDFDuet-KAR-GDH

[0061] (1) Design primer pair P1-F: GGAATTCCATATGATGATCATTTCCGCTTCCACC, P1-R: CCCAAGCTTTCAGGCGCCCAGTTCGCGGACCA. The genomic DNA in PseudomonasaeruginosaCCTCCM2011394 was used as a PCR template for PCR amplification. The PCR reaction process was as follows: 95°C for 5min, 95°C for 1min, 57°C for 1min, 72°C for 1min (30cycles); 72°C for 10min, 4°C forever.

[0062] The reaction system is as follows:

[0063]

[0064] The amplified product is the gene sequence of 2-hydroxyacid dehydrogenase 2-HADH, which is denoted as HADH1 (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2). The PCR product was purified by agarose gel electrophoresis, and the target band was recovered using an agarose gel DNA recovery kit. After double digestion, it was ligated with the expression vector pET28b and transformed into E.coliBL21(DE3) to construct the E.co...

Embodiment 2

[0076] Construction of recombinant strain E.coliBL21(DE3) / pET28b-HADH2 / pCDFDuet-KAR-GDH

[0077] Synthesize the 2-hydroxyacid dehydrogenase 2-HADH gene sequence in Burkholderiaxenovorans LB400 (ABE35802.1), denoted as HADH2 (nucleotide sequence is shown in SEQIDNO.3, amino acid sequence is shown in SEQIDNO.4), connected to pET28b And it was transferred into E.coliBL21(DE3) to construct E.collBL21(DE3) / pET28b-HADH2 strain.

[0078] The construction of the recombinant plasmid pCDFDuet-KAR-GDH is the same as in Example 1, refer to figure 2 .

[0079] The three-enzyme expression system was constructed by the method of double plasmids in one bacterium, and the plasmids pET28b-HADH2 and pCDFDuet-KAR-GDH were mixed at a ratio of 1:1, and then transferred into E.coliBL21(DE3) by conventional heat shock method or electric shock method In the competent state, spread it on a double-antibody plate containing streptomycin and kanamycin, and select the E.coliBL21(DE3) / pET28b-HADH2 / pCDFDu...

Embodiment 3

[0081] Construction of recombinant strain E.coliBL21(DE3) / pET28b-HADH3 / pCDFDuet-KAR-GDH

[0082] The 2-hydroxyacid dehydrogenase 2-HADH gene sequence in the synthetic Pseudomonasputida is recorded as HADH3 (the nucleotide sequence is shown in SEQ ID NO.5, and the amino acid sequence is shown in SEQ ID NO.6), connected to pET28b and transferred to E .coliBL21(DE3), construct E.collBL21(DE3) / pET28b-HADH3 strain.

[0083] The construction of the recombinant plasmid pCDFDuet-KAR-GDH is the same as in Example 1, refer to figure 2 .

[0084] Construct a three-enzyme expression system by the method of double plasmids in one bacterium, mix the plasmids pET28b-HADH3 and pCDFDuet-KAR-GDH at a ratio of 1:1, and transfer them into E.coliBL21(DE3) by conventional heat shock method or electric shock method In the competent state, spread it on a double-antibody plate containing streptomycin and kanamycin, and select the E.coliBL21(DE3) / pET28b-HADH3 / pCDFDuet-KAR-GDH strain, and the operati...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for synthesizing (R)-2-hydroxy acid by a biological enzyme method. The method comprises the following steps of taking a wet cell mass obtained by fermenting a recombinant genetic engineering strain as a catalyst, racemization 2-hydroxy acid shown in a formula (I) as a substrate, glucose as a cosubstrate, and a buffer solution of which the pH value is 6.0 to 9.0 as a reaction medium to form a reaction system; performing a conversion reaction under the conditions that the temperature is 20 to 50DEG C and the rotating speed is 150rpm; after the reaction is complete, separating and purifying a reaction solution to obtain the (R)-2-hydroxy acid, wherein the recombinant genetic engineering strain is recombinant escherichia coli containing 2-hydroxy acid dehydrogenase (HADH) genes, carbonyl reductase KAR genes and glucose dehydrogenase (GDH) genes. According to a single-bacteria, double-plasmid and trienzyme co-expression system disclosed by the invention, the conversion between the racemization 2-hydroxy acid and single-configuration (R)-2-hydroxy acid through an engineering strain is innovatively and successfully realized, the culture of multiple bacteria is avoided, the total concentration of bacteria is reduced, the reaction process is simplified, and extraction steps of an intermediate product are reduced; in addition, the catalytic efficiency is also remarkably improved; the system is more suitable for industrial application of a cascade catalysis system.

Description

(1) Technical field [0001] The present invention relates to a preparation method of (R)-2-hydroxyacid, in particular to a method for producing (R)-2 from racemized 2-hydroxyacid by co-expression of single bacterium double plasmid and three enzymes in series redox cascade system - Hydroxy acid method. (2) Background technology [0002] 2-hydroxycarboxylic acid compounds (2-hydroxyacids) are a class of compounds with similar structures, and their structural feature is that there is a hydroxyl group at the C1 position of the carboxyl side. 2-Hydroxycarboxylic acid is very active because it has two functional groups of ketone and hydroxyl. Optically pure 2-hydroxyacid chiral modules are important fine chemical intermediates and chiral drug precursors, and 2-hydroxyacid enantiomers are also important chiral resolution agents and chiral catalysts. Catalysts for the asymmetric conversion of aliphatic and aromatic aldehydes to the corresponding chiral alcohols. Optically active 2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P41/00C12P7/42C12R1/19
CPCC12P7/42C12P41/002
Inventor薛亚平郑裕国曾浩金晓鲁柳志强
OwnerZHEJIANG UNIV OF TECH