Design method for primers and probe for amplifying low-concentration mutation target sequence

A design method and target sequence technology, applied in the field of molecular biology, can solve the problems of limited detection ability, poor selectivity, false negative detection, etc., to increase the specificity of amplification, ensure specificity and efficiency, process optimized effect

Active Publication Date: 2016-08-17
CREATIVE BIOSCIENCES (GUANGZHOU) CO LTD
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When using PCR technology to detect gene mutations, especially when the amount of wild-type DNA accounts for a large proportion (that is, fewer mutations), the shortcomings of existing PCR technology are mainly reflected in the design of primers and probes, specifically as follows: ① specificity Poor selectivity, primers and probes designed according to common methods for gene mutations often produce non-specific amplification bands; The ability to detect mutant DNA is limited, and most of the tumor-causing mutations are somatic mutations, and mutant cells are mixed with wild-type cells, so the extracted DNA also contains a large amount of wild-type DNA;③ When the sample size is small, or there is complex background interference in the sample, it is difficult to use the extracted DNA to produce effective DNA amplification, and even lead to no detection, or false negative detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Design method for primers and probe for amplifying low-concentration mutation target sequence
  • Design method for primers and probe for amplifying low-concentration mutation target sequence
  • Design method for primers and probe for amplifying low-concentration mutation target sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] 1. Use the method of the present invention to design primers and probes, and carry out G on the 12th codon of Kras gene G T>G C Fluorescence PCR amplification assay of different gradients of T mutant and control wild-type samples.

[0063] The wild-type gene sequence and G G T>G C For T mutant gene sequence, a probe was designed as Kras-Pb; primers were respectively Kras-Fp and Kras-Rp.

[0064] Specifically, the primer and probe sequences designed according to the method of the present invention are as follows:

[0065] Kras-0Fp: CACTCTTGCCTACGCCTG;

[0066] Kras-0Pb: TGCAGTCCAACTACCAC;

[0067] Kras-ORp: GGCCTGCTGAAAATGACTG.

[0068] The primers and probes designed according to the general conventional primer and probe design method are as follows:

[0069] Kras-1Fp: CACTCTTGCCTACGCCTG;

[0070] Kras-1Pb: GCTCCAACTACCACAAGTT;

[0071] Kras-1Rp: GGCCTGCTGAAAATGACTG.

[0072] 2. Sample preparation:

[0073] Artificially synthesized a section with G G T>G C ...

Embodiment 2

[0089] 1. Use the primers and probes designed by the patent of the present invention to detect the BRAF V600E mutation.

[0090] According to the wild-type and mutant sequences of the BRAF gene queried from the cosmic data, the following primers and probes were designed:

[0091] BRAFV600E primers and probes designed according to the inventive method:

[0092] BRAF-0Fp: CCCACTCCATCGAGATGTCT;

[0093] BRAF-0Rp: TGAAGACCTCACAGTAAAA;

[0094] BRAF-OPb:CTCTGTAGCTAGACCA.

[0095] BRAFV600E primer and probe sequences designed according to common methods:

[0096] BRAF-1Fp: CCCACTCCATCGAGATTTCT;

[0097] BRAF-1Rp: TGAAGACCTCACAGTAAAA;

[0098] BRAF-1Pb:CTGTAGCTAGACCAA.

[0099] 2. Sample preparation:

[0100] Artificially synthesize a sequence with BRAFV600E mutation and the corresponding BRAF wild sequence, and load these two sequences into plasmids for amplification. Use the enzyme digestion system to digest the synthetic plasmid and obtain 10^4 copies of the restriction fr...

Embodiment 3

[0116] 1. Use the primers and probes designed by the method of the present invention and the primers and probes designed according to the common method to detect the mutation of PIK3CA gene c.3140A>G and compare the effects.

[0117] According to the wild-type and mutant sequences of the PIK3CA gene queried from the cosmic data, the following primers and probes were designed:

[0118] PIK3CAc.3140A>G primers and probes designed according to the method of the present invention:

[0119] PIK-0Fp: AACAAATGAATGATGCGCG

[0120] PIK-0Rp: TGCATGCTGTTTAATTGTGTGG

[0121] PIK-0Pb: CGTCATGGTGGCTGGACAACA

[0122] PIK3CAc.3140A>G primer and probe sequences designed according to common methods:

[0123] PIK-1Fp: CAAATGAATGATGCACG

[0124] PIK-1Rp: TGCATGCTGTTTAATTGTGTGG

[0125] PIK-1Pb: ATGGTGGCTGGACAACA

[0126] 2. Sample preparation:

[0127] A sequence with a PIK3CA c.3140A>G mutation and the corresponding wild sequence of PIK3CA were artificially synthesized, and the two sequen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Pre-denaturedaaaaaaaaaa
Login to View More

Abstract

The invention discloses a design method for primers and a probe for amplifying a low-concentration mutation target sequence. The design method includes the steps that the mutation position (a mutational site, namely a 0 site) of a target sequence to be amplified is determined; a 15-25 bp nucleic acid fragment including the 0 site base is selected in the negative direction of the mutational site to serve as the forward primer, and a 12-25 bp nucleic acid sequence is selected from the 1 site base or the 0 site base in the positive direction of the mutational site to serve as a probe sequence of an amplification system; the reverse primer is designed at the suitable position of the 3'direction downstream of the probe sequence according to a conventional method. According to the design method for the primers and the probe, the target fragment can be effectively (with high specificity and efficiency) amplified under the background of a high-content wild type template particularly for point mutation, deletion mutation and insertion mutation in gene mutation, a fluorescence real-time PCR technology is combined, and the problem that at present, sensitivity is poor in clinic tumor detection and drug susceptibility detection can be solved effectively.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and relates to a new method for designing nucleic acid primers and probes. More specifically, it relates to a method for designing primers and probes for amplifying low-concentration mutated target sequences. technical background [0002] Many diseases are closely related to gene mutations, and the type and generation of post-medication reactions in many cases are also related to gene mutations. The detection of gene mutations is of great significance in many fields and under certain circumstances, and the detection technology of gene mutations often uses PCR detection technology. PCR (Polymerase Chain Reaction) is the polymerase chain reaction, which refers to the DNA polymerase catalysis, using the parent chain DNA as a template, using a specific primer as the starting point of extension, and through steps such as denaturation, annealing, and extension, in vitro replication and parent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11C12N15/10
CPCC12Q1/6811C12Q1/6858C12Q2527/107C12Q2563/107C12Q2531/113C12N15/10C12N15/11C12Q1/68
Inventor邹鸿志牛智通
OwnerCREATIVE BIOSCIENCES (GUANGZHOU) CO LTD