Kit and method for detecting staphylococcus aureus and integron in food
A staphylococcus aureus and aureus technology, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, can solve the problems of staphylococcus aureus and integron detection that have not been reported, and achieve good industry Prospect of chemicalization, rapid detection, reasonable composition and proportioning effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] The present invention detects the primers and probes of Staphylococcus aureus and integron int1 in food, and the sequences of the primers and probes are respectively:
[0051] Upstream primer SAF: ATTCCGGATAACGCTTGCCA
[0052] Downstream primer SAR: AGGGAATCTTCCGCAATGGG
[0053] Probe SAP: GCGGCGTTGCTCCGTCA
[0054] Upstream primer int1F: CATCGTCGTAGAGACGTCGG
[0055] Downstream primer Int1R: AGAACAAGCAGGCATCACGA
[0056] Probe Int1P: AGGGTGTGCGGTGTGGCGGGC
Embodiment 2
[0058] The present invention is a test kit for detecting Staphylococcus aureus and integron int1 in food, wherein 20 wherein the reaction system comprises the following components:
[0059] 2×ddPCR Super Mix 10.0 μL, Staphylococcus aureus and int1 forward and reverse primers 1.0 μL each, probe 1.0 μL each, DNA template 4.0 μL.
[0060] Wherein the sequences of primers and probes are as follows:
[0061] Upstream primer SAF: ATTCCGGATAACGCTTGCCA
[0062] Downstream primer SAR: AGGGAATCTTCCGCAATGGG
[0063] Probe SAP: GCGGCGTTGCTCCGTCA
[0064] Upstream primer int1F: CATCGTCGTAGAGACGTCGG
[0065] Downstream primer Int1R: AGAACAAGCAGGCATCACGA
[0066] Probe IntlP: AGGGTGTGCGGTGTGGCGGGC.
Embodiment 3
[0068] The method for detecting Staphylococcus aureus and integron int1 in food of the present invention comprises the following steps:
[0069] A. Extract sample DNA;
[0070] Add each reaction component to a 20.0 μl reaction system, then add 70.0 μl mineral oil, mix well and transfer to a droplet generator to automatically generate droplets; the 20.0 μl reaction body includes 10.0 μL of 2×ddPCR Super Mix, golden yellow Staphylococcus and int1 forward and reverse primers 1.0 μL each, probe 1.0 μL each, DNA template 4.0 μL.
[0071] B. Carefully transfer all the generated micro-droplets to the PCR reaction tube of the 96-well reaction plate; then seal the 96-well reaction plate on a film sealing machine, and place it in an ordinary PCR machine for PCR reaction.
[0072] C. Open the application software of the droplet fluorescence detector, insert the 96-well reaction plate after the PCR reaction directly into the device, detect the PCR reaction of the droplet in each PCR reac...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 