Check patentability & draft patents in minutes with Patsnap Eureka AI!

Kit and method for detecting staphylococcus aureus and integron in food

A staphylococcus aureus and aureus technology, which is applied in the direction of microorganism-based methods, biochemical equipment and methods, and microbial determination/inspection, can solve the problems of staphylococcus aureus and integron detection that have not been reported, and achieve good industry Prospect of chemicalization, rapid detection, reasonable composition and proportioning effect

Inactive Publication Date: 2016-10-26
INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY EXIT INSPECTION AND QUARANTINE
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, there are few reports on the analysis of copy number based on the droplet digital PCR platform, let alone the detection of Staphylococcus aureus and integrons.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for detecting staphylococcus aureus and integron in food
  • Kit and method for detecting staphylococcus aureus and integron in food
  • Kit and method for detecting staphylococcus aureus and integron in food

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] The present invention detects the primers and probes of Staphylococcus aureus and integron int1 in food, and the sequences of the primers and probes are respectively:

[0051] Upstream primer SAF: ATTCCGGATAACGCTTGCCA

[0052] Downstream primer SAR: AGGGAATCTTCCGCAATGGG

[0053] Probe SAP: GCGGCGTTGCTCCGTCA

[0054] Upstream primer int1F: CATCGTCGTAGAGACGTCGG

[0055] Downstream primer Int1R: AGAACAAGCAGGCATCACGA

[0056] Probe Int1P: AGGGTGTGCGGTGTGGCGGGC

Embodiment 2

[0058] The present invention is a test kit for detecting Staphylococcus aureus and integron int1 in food, wherein 20 wherein the reaction system comprises the following components:

[0059] 2×ddPCR Super Mix 10.0 μL, Staphylococcus aureus and int1 forward and reverse primers 1.0 μL each, probe 1.0 μL each, DNA template 4.0 μL.

[0060] Wherein the sequences of primers and probes are as follows:

[0061] Upstream primer SAF: ATTCCGGATAACGCTTGCCA

[0062] Downstream primer SAR: AGGGAATCTTCCGCAATGGG

[0063] Probe SAP: GCGGCGTTGCTCCGTCA

[0064] Upstream primer int1F: CATCGTCGTAGAGACGTCGG

[0065] Downstream primer Int1R: AGAACAAGCAGGCATCACGA

[0066] Probe IntlP: AGGGTGTGCGGTGTGGCGGGC.

Embodiment 3

[0068] The method for detecting Staphylococcus aureus and integron int1 in food of the present invention comprises the following steps:

[0069] A. Extract sample DNA;

[0070] Add each reaction component to a 20.0 μl reaction system, then add 70.0 μl mineral oil, mix well and transfer to a droplet generator to automatically generate droplets; the 20.0 μl reaction body includes 10.0 μL of 2×ddPCR Super Mix, golden yellow Staphylococcus and int1 forward and reverse primers 1.0 μL each, probe 1.0 μL each, DNA template 4.0 μL.

[0071] B. Carefully transfer all the generated micro-droplets to the PCR reaction tube of the 96-well reaction plate; then seal the 96-well reaction plate on a film sealing machine, and place it in an ordinary PCR machine for PCR reaction.

[0072] C. Open the application software of the droplet fluorescence detector, insert the 96-well reaction plate after the PCR reaction directly into the device, detect the PCR reaction of the droplet in each PCR reac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers, probes, a kit and a method for detecting staphylococcus aureus and integron int1 in food. The primers comprise staphylococcus aureus primers and integron primers; sequences of the staphylococcus aureus primers are as follows: a sequence of a forward primer SAF is ATTCCGGATAACGCTTGCCA, and a sequence of a reverse primer SAR is AGGGAATCTTCCGCAATGGG; sequences of the integron primers are as follows: a sequence of a forward primer int1F is CATCGTCGTAGAGACGTCGG, and a sequence of a reverse primer Int1R is AGAACAAGCAGGCATCACGA. The invention provides the primers, probes, kit and method for detecting the staphylococcus aureus and the integron in the food. The kit is reasonable in ingredients and proportioning ratio, convenient in use and quick and accurate in detection; the method for detecting the staphylococcus aureus and the integron int1 in the food by the kit is simple, convenient and rapid in operation, low in cost and accurate in detection result.

Description

technical field [0001] The invention relates to a primer for detecting Staphylococcus aureus and integron int1 in food; the invention also relates to a probe used in conjunction with the above primer; the invention also relates to a double droplet comprising the above primer and probe A digital PCR detection kit, referred to as a ddPCR detection kit; the present invention also relates to a method for detecting Staphylococcus aureus and integron int1 in food by using the above kit. Background technique [0002] There are many opportunities for food contamination by Staphylococcus aureus, or SA for short. Staphylococcus aureus in my country has sparked standard controversy due to incidents at Missing, Sanquan, and Wanchai Wharf. In the new national standard for quick-frozen food implemented on December 21, 2011, Staphylococcus aureus has changed from "no detection" to "limited detection" "Out", but this change in detection standards does not mean that the hazards of Staphyloco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/14C12N15/11C12R1/445
CPCC12Q1/689C12Q1/6851C12Q2600/16C12Q2531/113C12Q2563/159C12Q2537/143
Inventor 蔡先全吴冰王静邱德义萧崎倩邱霞张杰豪
Owner INSPECTION AND QUARANTINE TECHNOLOGY CENTER ZHONGSHAN ENTRY EXIT INSPECTION AND QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More