Saccharomyces cerevisiae genome editing carrier based on CRISPR-Cas9 system and application of carrier

A technology of genome editing and Saccharomyces cerevisiae, applied in the direction of microorganism-based methods, vectors, nucleic acid vectors, etc., can solve the problems of long experimental period, cumbersome editing system construction, and the impact of double-plasmid plasmid compatibility, etc., and achieve the effect of easy operation

Inactive Publication Date: 2016-11-09
SUZHOU HONGXUN BIOTECH CO LTD
View PDF4 Cites 42 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional genome editing technology uses homologous recombination mechanism (homologous recombination) to edit genes in a targeted manner, which can help researchers clarify the function of genes. Traditional genome editing technology uses long fragments of DNA as target sites, and the "positioning system" must also It is a long DNA fragment, the construction of the editing system is complex and time-consuming, the experiment cycle is long, the efficiency is very low, and the gene is easy to mutate and other defects
The second-generation genome editing technology (including ZFN system and TALEN system) has solved the problem of low specificity of the editing system to a certain extent, but still failed to solve the outstanding problems of cumbersome and time-consuming construction of the editing system
Since the CRISPR-Cas9 system uses a two-plasmid system, it is difficult to construct, and the two-plasmid is easily affected by plasmid compatibility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharomyces cerevisiae genome editing carrier based on CRISPR-Cas9 system and application of carrier
  • Saccharomyces cerevisiae genome editing carrier based on CRISPR-Cas9 system and application of carrier
  • Saccharomyces cerevisiae genome editing carrier based on CRISPR-Cas9 system and application of carrier

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] 1. Design the following sequence based on the known sequence:

[0053] 1) Yeast Cas9 protein expression cassette (TEF1promoter-Cas9-CYC1terminitor), including TEF1 promoter, Cas9 protein, CYC1 terminator, the sequence is shown in SEQ ID NO.1, wherein: CGAACGCCATCGACTTACCAGTATGCTACTTACTAT and CAGCAGGAGCTGGACTCTACTGATGTCTGGACAGC at the beginning and end of the sequence of SEQ ID NO.1 are Cas9 protein expression cassette and pSynoYACO vector homology arm sequence; ggcgcgcc and ggcgcgcc are AscI restriction site sequences, GTTTAAAC is PmeI restriction site.

[0054] 2) The sequence of the sgRNA scaffold expression box (SNR52 promoter+sgRNA Scaffold+SUP4terminitor) is shown in SEQ ID NO.2, wherein: GGACGCTCGAAGGCTTTAATTTGC and gctgctaacaaagcccgaaag at the beginning and end of the sequence of SEQ ID NO.2 are the homology arms of the sgRNA Scaffold expression box and the pSynoYACO-Cas9 vector Sequence, GTTTAAAC is the sequence of the restriction site of PmeI.

[0055] 3) Prim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a saccharomyces cerevisiae genome editing carrier based on a CRISPR-Cas9 system and application of the carrier. According to the saccharomyces cerevisiae genome editing carrier, a Cas9 protein expression cassette and an sgRNA scaffold expression cassette are integrated in the carrier, and a carrier-Cas9-sgRNA scaffold is obtained; any one of multiple sgRNA fragments which are designed and synthesized by taking ADE1 as a target site is integrated in the carrier-Cas9-sgRNA scaffold, and the saccharomyces cerevisiae genome editing carrier is obtained. According to the saccharomyces cerevisiae genome editing carrier based on the CRISPR-Cas9 system and the application of the carrier, a single plasmid and single copy carrier system is adopted, one plasmid is adopted to express Cas9 protein and sgRNA scaffold simultaneously, construction and conversion of a target gene editing system only need one step, and operation is easy and convenient.

Description

technical field [0001] The invention relates to a Saccharomyces cerevisiae genome editing vector based on a CRISPR-Cas9 system and an application thereof. Background technique [0002] With the completion of human genome sequencing, life science research has entered a post-genome era aimed at revealing gene functions, and genome editing technology has become an important research tool and means. Traditional genome editing technology uses homologous recombination mechanism (homologous recombination) to edit genes in a targeted manner, which can help researchers clarify the function of genes. Traditional genome editing technology uses long fragments of DNA as target sites, and the "positioning system" must also It is a long DNA fragment, the construction of the editing system is complex and time-consuming, the experiment cycle is long, the efficiency is very low, and the gene is prone to mutation and other defects. The second-generation genome editing technology (including ZF...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N15/66C12N1/18C12R1/865
CPCC12N15/81C12N1/18C12N15/66C12N2800/102C12N2800/80
Inventor季广建钟云鹏蔡晓辉李彦敏杨平
OwnerSUZHOU HONGXUN BIOTECH CO LTD