Saccharomyces cerevisiae genome editing carrier based on CRISPR-Cas9 system and application of carrier
A technology of genome editing and Saccharomyces cerevisiae, applied in the direction of microorganism-based methods, vectors, nucleic acid vectors, etc., can solve the problems of long experimental period, cumbersome editing system construction, and the impact of double-plasmid plasmid compatibility, etc., and achieve the effect of easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] 1. Design the following sequence based on the known sequence:
[0053] 1) Yeast Cas9 protein expression cassette (TEF1promoter-Cas9-CYC1terminitor), including TEF1 promoter, Cas9 protein, CYC1 terminator, the sequence is shown in SEQ ID NO.1, wherein: CGAACGCCATCGACTTACCAGTATGCTACTTACTAT and CAGCAGGAGCTGGACTCTACTGATGTCTGGACAGC at the beginning and end of the sequence of SEQ ID NO.1 are Cas9 protein expression cassette and pSynoYACO vector homology arm sequence; ggcgcgcc and ggcgcgcc are AscI restriction site sequences, GTTTAAAC is PmeI restriction site.
[0054] 2) The sequence of the sgRNA scaffold expression box (SNR52 promoter+sgRNA Scaffold+SUP4terminitor) is shown in SEQ ID NO.2, wherein: GGACGCTCGAAGGCTTTAATTTGC and gctgctaacaaagcccgaaag at the beginning and end of the sequence of SEQ ID NO.2 are the homology arms of the sgRNA Scaffold expression box and the pSynoYACO-Cas9 vector Sequence, GTTTAAAC is the sequence of the restriction site of PmeI.
[0055] 3) Prim...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com