Method for obtaining bmp2a gene knocked-out zebra fish through CRISPR/Cas9

Abstract

The invention discloses a method for obtaining bmp2a gene knocked-out zebra fish through CRISPR / Cas9. A novel gRNA sequence is designed between a first exon and an intron of BMP2a, the gRNA sequence is GGAGCCCATCACTAGACTCTTGG, and enzyme digestion is HinfI. Compared with a traditional gene knockout technology, the CRISPR / Cas9 technology has the advantages of low toxicity, high accuracy, high efficiency, short success cycle and the like. Therefore, the BMP2a gene can be theoretically knocked out faster.

Description

technical field [0001] The present invention relates to a method for obtaining a zebrafish knockout bmp2a gene through CRISPR / Cas9. Background technique [0002] CRISPR / Cas9 is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight against invading viruses and foreign DNA. The CRISPR / Cas9 system provides immunity by integrating fragments of invading phage and plasmid DNA into CRISPR and using corresponding CRISPR RNAs (crRNAs) to direct the degradation of homologous sequences. The working principle of this system is that crRNA (CRISPR-derived RNA) combines with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex, which guides the nuclease Cas9 protein at the sequence target site paired with crRNA Shears double-stranded DNA. By artificially designing these two RNAs, they can be transformed into sgRNA (short guide RNA) with a guiding effect, which is enough to guide Cas9 to cut DN...

AI Technical Summary

Problems solved by technology

[0003] 1. Only one sgRNA needs to be synthesized to achieve specific modification of the gene, and the Cas protein is not specific

Images