Method for obtaining bmp2a gene knocked-out zebra fish through CRISPR/Cas9
A zebrafish and genetic technology, applied in other methods of inserting foreign genetic materials, using microinjection, animal husbandry, etc., can solve the problem of non-specificity of Cas protein
Inactive Publication Date: 2017-01-04
WUXI NO 2 PEOPLES HOSPITAL
View PDF2 Cites 44 Cited by
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
[0003] 1. Only one sgRNA needs to be synthesized to achieve specific modification of the gene, and the Cas protein is not specific
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View moreImage
Smart Image Click on the blue labels to locate them in the text.
Smart ImageViewing Examples
Examples
Experimental program
Comparison scheme
Effect test
specific Embodiment approach
[0056] The primers used in this example were all synthesized by Suzhou Jinweizhi Company. Wild-type zebrafish AB strain, Soochow University Biological Clock Research Center.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More PUM
Login to View More Abstract
The invention discloses a method for obtaining bmp2a gene knocked-out zebra fish through CRISPR / Cas9. A novel gRNA sequence is designed between a first exon and an intron of BMP2a, the gRNA sequence is GGAGCCCATCACTAGACTCTTGG, and enzyme digestion is HinfI. Compared with a traditional gene knockout technology, the CRISPR / Cas9 technology has the advantages of low toxicity, high accuracy, high efficiency, short success cycle and the like. Therefore, the BMP2a gene can be theoretically knocked out faster.
Description
technical field [0001] The present invention relates to a method for obtaining a zebrafish knockout bmp2a gene through CRISPR / Cas9. Background technique [0002] CRISPR / Cas9 is an adaptive immune defense formed during the long-term evolution of bacteria and archaea, which can be used to fight against invading viruses and foreign DNA. The CRISPR / Cas9 system provides immunity by integrating fragments of invading phage and plasmid DNA into CRISPR and using corresponding CRISPR RNAs (crRNAs) to direct the degradation of homologous sequences. The working principle of this system is that crRNA (CRISPR-derived RNA) combines with tracrRNA (trans-activating RNA) through base pairing to form a tracrRNA / crRNA complex, which guides the nuclease Cas9 protein at the sequence target site paired with crRNA Shears double-stranded DNA. By artificially designing these two RNAs, they can be transformed into sgRNA (short guide RNA) with a guiding effect, which is enough to guide Cas9 to cut DN...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More Application Information
Patent Timeline
Login to View More Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/89A01K67/027
CPCC12N15/89A01K67/0276A01K2217/075A01K2227/40A01K2267/03C07K14/461
Inventor 姜宇朱国兴仲兆民杨健易利华徐又佳
Owner WUXI NO 2 PEOPLES HOSPITAL

