Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Carrot beta(1,2)xylosetransferase gene full sequence and plasmid construction of CRISPR (clustered regularly interspaced short palindromic repeats)/CAS9 for dicotyledon transfection

A carrot and gene technology, applied in the field of CRISPR/CAS9 plasmid construction, can solve the problems of missing nucleotides, insertion of break sites, etc.

Active Publication Date: 2017-01-11
SHANGHAI JIAO TONG UNIV
View PDF0 Cites 30 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The NHEJ repair pathway is the most active repair pathway, capable of repairing DNA with double-strand breaks in a short period of time, but often results in insertion or deletion of nucleotides at the break site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carrot beta(1,2)xylosetransferase gene full sequence and plasmid construction of CRISPR (clustered regularly interspaced short palindromic repeats)/CAS9 for dicotyledon transfection
  • Carrot beta(1,2)xylosetransferase gene full sequence and plasmid construction of CRISPR (clustered regularly interspaced short palindromic repeats)/CAS9 for dicotyledon transfection
  • Carrot beta(1,2)xylosetransferase gene full sequence and plasmid construction of CRISPR (clustered regularly interspaced short palindromic repeats)/CAS9 for dicotyledon transfection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Extraction of Carrot Genomic DNA

[0065] 1. Experimental method

[0066] This step uses the Plant Genomic DNA Extraction Kit from Tiangen Biochemical Technology Co., Ltd.

[0067]The specific operation steps include:

[0068] Take about 100 mg of fresh carrot cell mass, add liquid nitrogen and grind thoroughly. Quickly transfer the ground powder to a centrifuge tube pre-filled with 700 μL of 65°C preheating buffer GP1 (before the experiment, mercaptoethanol needs to be added to the preheated GP1, and it is prepared and used now to make the final concentration 0.1%). After quickly inverting and mixing, place the centrifuge tube in a 65°C water bath for 20 minutes, and invert the centrifuge tube several times every 5 minutes during the water bath to mix the samples. Add 700 μL of chloroform, mix thoroughly, and centrifuge at 12,000 rpm for 5 min. Transfer the upper aqueous phase obtained in the previous step into a new centrifuge tube, add 700 μL buffer GP2...

Embodiment 2

[0071] Example 2 Obtaining XylT Fragment Using Nested PCR Technology

[0072] 1. Experimental method

[0073] (1) PCR reaction:

[0074] Using the carrot genomic DNA obtained in Example 1 as a template, use gene homology to obtain 3 exon sequences from the carrot database, design two pairs of primers on the outside and inside according to this sequence, and use the outside pair of primers to carry out the first PCR reaction . Then use the 10-fold dilution of the first PCR product as a template, and use the inner pair of primers for the second PCR reaction. The PCR primer sequences are shown in Table 1, and the reaction components are shown in Table 2. The cycle parameters of the first PCR reaction were 98° C. for 1 min, 95° C. for 0.5 min, 55° C. for 0.5 min, 68° C. for 10 min, 35 cycles, and 68° C. for 10 min. The cycle parameters of the second PCR reaction were 98° C. for 1 min, 95° C. for 0.5 min, 55° C. for 0.5 min, 68° C. for 6 min, 35 cycles, and 68° C. for 10 min. ...

Embodiment 3

[0095] Example 3 PCR product sequencing after XylT purification

[0096] 1. Experimental method

[0097] The PCR product purified in Example 2 was sent to Shanghai Huajin Biotechnology Co., Ltd. for sequencing. The outer two pairs of PCR primers were used as the first pair of sequencing primers, and the sequencing was carried out in the middle at the same time. According to the sequencing results, two pairs of primers were designed to continue the sequencing. The sequences of the sequencing primers are listed in Table 3.

[0098] Table 3 Sequencing primer sequences

[0099] Sequencing primer name Primer sequence (5'-3') serial number W1F GCTTATTTTGGTAATGGCTTTACTCGAC SEQ ID NO.5 W1R CAAGAATAGGATGGTACTCTAATC SEQ ID NO.6 W2F AATCCTTTTCTGGAGTTGAG SEQ ID NO.7 W2R GGCTGTTGCCACAGATCATG SEQ ID NO.8 W3F CGTATTACTATGAGGCGAGG SEQ ID NO.9 W3R ATGCAGCATACCAATCTGTAACTG SEQ ID NO.10 W4F GATTTCTTGATGGCATGGTCAAG SE...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and particularly relates to a carrot beta(1,2)xylosetransferase gene full sequence and plasmid construction of CRISPR (clustered regularly interspaced short palindromic repeats) / CAS9 for dicotyledon transfection. The carrot beta(1,2)xylosetransferase gene full sequence is discovered and determined for the first time, two effective gRNAs are designed aiming at the sequence to realize synthesis of corresponding CRISPR / CAS9 plasmids, and thus knockout of beta(1,2)xylosetransferase in suspension carrot cell genomes can be realized. In addition, two STR loci are found in the beta(1,2)xylosetransferase gene sequence, which is remarkably significant to species identification and evolution of carrots.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the complete gene sequence of β(1,2) xylosyltransferase in the genome of suspended carrot cells and the construction of corresponding CRISPR / CAS9 plasmids for transfection of dicotyledonous plants. Background technique [0002] The use of plants to express heterologous proteins is a technology that only began nearly three decades ago. In 1986, the first pharmacologically active protein, human growth hormone, was successfully expressed in transgenic tobacco. Since then, various human-associated proteins have been expressed by different plant species. From the birth of the first plant-expressed antibody in 1989 to the appearance of the first plant vaccine in 1992, the status of genetically modified plants in the field of biology has gradually increased. [0003] Currently, more mature protein expression systems on the market include bacterial expression, yeast, mammalian ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/54C12N15/113C12N15/82
CPCC12N9/1081C12N15/113C12N15/8216C12N2310/10C12N2800/80C12Q1/6848C12Q2549/119
Inventor 李大伟荣荣胡凌云苏其达武正华周冰洁必思沃思
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com