Prokineticin 2 as biomarker for psoriasis and its use
A biomarker and psoriasis technology, applied in the field of medical molecular biology, can solve the problems of unclear mechanism of increasing the healing rate and no public reports, and achieve the effect of promoting the occurrence of psoriasis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1: Comparison of PK2 content detection in the blood and skin of psoriasis patients and healthy people
[0059] The detection of PK2 in blood was a conventional enzyme-linked immunosorbent assay (ELISA), and the kit was purchased from cusabio.com. The specific steps are operated according to the instructions. The detection of PK2 in the skin adopts three methods: reverse high pressure liquid chromatography (RP-HPLC), immunohistochemistry (IHC) and ELISA. Before RP-HPLC and ELISA, the quantitative skin tissue was homogenized, and the protein was quantified before detection.
[0060] like figure 1 -7 shows, figure 1 Indicates: HPLC method to detect PK2 content in healthy human skin; figure 2 Indicates: HPLC method to detect the PK2 content in the skin of psoriasis patients; image 3 Indicates: mass spectrometric identification judges the peak indicated by the arrow as PK2 by molecular weight; Figure 4 Indicates: IHC detection of PK2 expression comparison in...
Embodiment 2
[0062] Example 2: Detection of PK2 in the skin of psoriasis mice and normal mice
[0063] Take imiquimod-induced mouse psoriasis model skin homogenate, K14-VEGF transgenic psoriasis mouse model skin homogenate and normal mouse skin homogenate for western blot of PK2.
[0064] The result is as Figure 8 As shown, the expression of PK2 in imiquimod-induced psoriasis mouse skin and K14-VEGF transgenic psoriasis mouse model skin was significantly higher than that in normal mouse skin (p<0.01), the results showed that HPLC The content of PK2 in the skin of psoriasis patients is also much higher than that of healthy people by HPLC method. The analysis results of IHC also show that the expression of PK2 in the skin of psoriasis patients is much higher than that of healthy people. Expression is upregulated in the blood and skin of patients.
Embodiment 3
[0065] Example 3: Construction of PK2 overexpression lentivirus and knockdown retrovirus
[0066] Construction of lentiviral vector: The mouse PK2 target gene and PLVX-puro lentiviral vector were digested with EcoRI and BamHI, and then PK2 was connected to the PLVX-puro vector.
[0067] Reverse transcription vector construction: According to the literature of Cheng, M.Y. et al, an effective siRNA sequence against mouse PK2 was designed, and the corresponding oligonucleotide sequence CATAAGGATCTGCACACCTATCTCGAGATAGGTGTGCAGATCCTTATGTTTT was synthesized chemically, and the disordered sequence AGTACTGCTTACGATACGGTTCAAGCGACCGTATCGTATTAGCAGTACTTTTT of the above sequence was synthesized as a control sequence. And the synthesized sequence was connected to the RNAi-Ready pSIREN-RetroQ retroviral vector digested with BamHI and EcoRI to form psh-PK2 or psh-Scr.
[0068] Lentiviral packaging: The constructed lentiviral vector PLVX-PK2 and its helper plasmids pMD1g / PRRE, Prsv-REV and pMD2....
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com