Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Prokineticin 2 as biomarker for psoriasis and its use

A biomarker and psoriasis technology, applied in the field of medical molecular biology, can solve the problems of unclear mechanism of increasing the healing rate and no public reports, and achieve the effect of promoting the occurrence of psoriasis

Active Publication Date: 2017-01-11
KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, angiogenesis and epidermal cell proliferation; psoriasis has also been documented to increase wound healing rates, but the mechanism by which this increases healing rates is unclear
And what is the connection between PK2 and IL-1, and what is the relationship with the occurrence and development of psoriasis? Through literature search, there is no public report identical with the present invention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Prokineticin 2 as biomarker for psoriasis and its use
  • Prokineticin 2 as biomarker for psoriasis and its use
  • Prokineticin 2 as biomarker for psoriasis and its use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: Comparison of PK2 content detection in the blood and skin of psoriasis patients and healthy people

[0059] The detection of PK2 in blood was a conventional enzyme-linked immunosorbent assay (ELISA), and the kit was purchased from cusabio.com. The specific steps are operated according to the instructions. The detection of PK2 in the skin adopts three methods: reverse high pressure liquid chromatography (RP-HPLC), immunohistochemistry (IHC) and ELISA. Before RP-HPLC and ELISA, the quantitative skin tissue was homogenized, and the protein was quantified before detection.

[0060] like figure 1 -7 shows, figure 1 Indicates: HPLC method to detect PK2 content in healthy human skin; figure 2 Indicates: HPLC method to detect the PK2 content in the skin of psoriasis patients; image 3 Indicates: mass spectrometric identification judges the peak indicated by the arrow as PK2 by molecular weight; Figure 4 Indicates: IHC detection of PK2 expression comparison in...

Embodiment 2

[0062] Example 2: Detection of PK2 in the skin of psoriasis mice and normal mice

[0063] Take imiquimod-induced mouse psoriasis model skin homogenate, K14-VEGF transgenic psoriasis mouse model skin homogenate and normal mouse skin homogenate for western blot of PK2.

[0064] The result is as Figure 8 As shown, the expression of PK2 in imiquimod-induced psoriasis mouse skin and K14-VEGF transgenic psoriasis mouse model skin was significantly higher than that in normal mouse skin (p<0.01), the results showed that HPLC The content of PK2 in the skin of psoriasis patients is also much higher than that of healthy people by HPLC method. The analysis results of IHC also show that the expression of PK2 in the skin of psoriasis patients is much higher than that of healthy people. Expression is upregulated in the blood and skin of patients.

Embodiment 3

[0065] Example 3: Construction of PK2 overexpression lentivirus and knockdown retrovirus

[0066] Construction of lentiviral vector: The mouse PK2 target gene and PLVX-puro lentiviral vector were digested with EcoRI and BamHI, and then PK2 was connected to the PLVX-puro vector.

[0067] Reverse transcription vector construction: According to the literature of Cheng, M.Y. et al, an effective siRNA sequence against mouse PK2 was designed, and the corresponding oligonucleotide sequence CATAAGGATCTGCACACCTATCTCGAGATAGGTGTGCAGATCCTTATGTTTT was synthesized chemically, and the disordered sequence AGTACTGCTTACGATACGGTTCAAGCGACCGTATCGTATTAGCAGTACTTTTT of the above sequence was synthesized as a control sequence. And the synthesized sequence was connected to the RNAi-Ready pSIREN-RetroQ retroviral vector digested with BamHI and EcoRI to form psh-PK2 or psh-Scr.

[0068] Lentiviral packaging: The constructed lentiviral vector PLVX-PK2 and its helper plasmids pMD1g / PRRE, Prsv-REV and pMD2....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an endogenous regulatory peptide prokineticin 2 (PK2) as a biomarker for psoriasis and its use, and belongs to the field of medical molecular biology. The inventor found that PK2 has a new biological function that promotes wound healing and psoriasis by detecting the expression of PK2 in the blood and skin of psoriasis as a biomarker for detecting the occurrence or development of psoriasis. The invention also relates to the use of PK2 in the treatment or detection of psoriasis and its use in wound healing. The invention has found that PK2 has the function of promoting the occurrence of psoriasis and can detect the occurrence or development of psoriasis by detecting the expression of PK2 in skin and blood of psoriasis. PK2 can be used as the specificity biomarker of the occurrence or development of psoriasis; PK2 as a target has a very good effect on the treatment of psoriasis, and the treatment of psoriasis provides a new target. In addition, the invention also relates to the activity of PK2 to promote wound healing and to provide a new drug template for wound healing.

Description

[0001] Technical field: [0002] The present invention relates to a kind of Prokineticin2 (abbreviated as PK2) as a psoriasis biomarker and its application, specifically endogenous regulatory peptide prokineticin2 (abbreviated as PK2) as a psoriasis biomarker and its application, belonging to medical molecular biology technology field. [0003] Background technique: [0004] In the field of skin diseases, psoriasis is a common chronic recurrent complex disease mainly manifested by erythema and scales, and is listed by the World Health Organization as one of the two chronic diseases in the field of human skin diseases in the 20th century First, the incidence rate of this disease is as high as 2% among Caucasians, while it is 0.123% among the Chinese population. There are about 5 million individuals suffering from it in China, and the net increase of cases is increasing at a rate of 100,000 cases per year. Psoriasis, commonly known as "psoriasis", is prone to recurrence, difficu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68A61K38/17A61P17/02A61P17/06
CPCA61K38/17G01N33/6893G01N2800/205
Inventor 赖仞何小芹
Owner KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com