Primer for detecting WRAP53 gene mutation and application of primer

A technology for sequencing primers and genes, which is applied in the fields of life sciences and biology, and can solve problems such as fewer cases, less gene detection, and more WRAP53 gene mutation points

A technology for sequencing primers and genes, which is applied in the fields of life sciences and biology, and can solve problems such as fewer cases, less gene detection, and more WRAP53 gene mutation points

CN106399567AInactive Publication Date: 2017-02-15杭州华硕医学检验实验室有限公司

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting WRAP53 gene mutation and application of primer
  • Primer for detecting WRAP53 gene mutation and application of primer
  • Primer for detecting WRAP53 gene mutation and application of primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0128] A primer for detecting WRAP53 gene mutation, comprising:

[0129] The primers for amplifying the whole exon sequence of WRAP53 gene, its base sequence is:

[0130] WRAP53-1a F is shown in SEQ ID NO: 1:

[0131] TGTAAAACGACGGCCAGTGGGAACGGGAAACCTTCTAA

[0132] WRAP53-1a R is shown in SEQ ID NO: 2:

[0133] AACAGCTATGACCATGGACAGCAGTCCGGAGCTAAC

[0134] WRAP53-1b F is shown in SEQ ID NO: 3:

[0135] TGTAAAACGACGGCCAGTCTAATCTCCGCTGTGCTTCC

[0136] WRAP53-1b R is shown in SEQ ID NO: 4:

[0137] AACAGCTATGACCATGTCTTCTGCAGGAAGGCTTGT

[0138] WRAP53-1c F is shown in SEQ ID NO: 5:

[0139] TGTAAAACGACGGCCAGTGGGACCCAGTTTCTCTCTCC

[0140] WRAP53-1c R is shown in SEQ ID NO: 6:

[0141] AACAGCTATGACCATGCTGGAGAAGTGGGTCTCAGG

[0142] WRAP53-2F is shown in SEQ ID NO: 7:

[0143] TGTAAAACGACGGCCAGTGTGGAGTCTGGGGAGATGAA

[0144] WRAP53-2R is shown in SEQ ID NO: 8:

[0145] AACAGCTATGACCATGGGGCATCCCTCTCCTAGAAA

[0146] WRAP53-3F is shown in SEQ ID NO: 9:

[0147] TGTAAAACGACG...

Embodiment 2

[0196] Operation process of blood / cell / tissue genomic DNA extraction kit (Tiangen Biology):

[0197] (1) Extraction of genomic DNA in blood: 1) Extract 300 μl of blood and add 900 μl of erythrocyte lysate, mix by inversion, and place at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed. 2) Add 20 μl proteinase K solution and mix well. 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap. 5) Add the solution and flocculent precipitate obtained in the previous s...

Embodiment 3

[0225] Two cases of clinical samples were taken to extract genomes, prepare reagents, amplify and sequence according to the reagents and methods of Examples 1 and 2. Electrophoresis results such as figure 2 and 3 Shown, show that the primers WRAP53-1a F / R, WRAP53-1b F / R, WRAP53-1cF / R, WRAP53-2F / R, WRAP53-3F / R, WRAP53-4F / R, WRAP53-5F of the present invention / R, WRAP53-6F / R, WRAP53-7aF / R, WRAP53-7bF / R, WRAP53-8F / R, WRAP53-9F / R, WRAP53-10F / R can effectively amplify blood samples with a single band .

[0226] The test results of sample 1 are as follows: Figure 4-13 Shown:

[0227] Figure 4 It shows the wild-type sequencing screenshot of WRAP53 exon 1 of sample 1, indicating that exon 1 of sample 1 is not mutated.

[0228] Figure 5 It shows the wild-type sequencing screenshot of WRAP53 exon 2 of sample 1, indicating that exon 2 of sample 1 is not mutated.

[0229] Figure 6 It shows the wild-type sequencing screenshot of WRAP53 exon 3 of sample 1, indicating that exon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer for detecting WRAP53 gene mutation of a patient with dyskeratosis congenita and application of the primer. The primer for detecting the WRAP53 gene mutation condition comprises a primer for amplifying a whole exon sequence of the WRAP53 gene as well as a sequencing primer for detecting the gene of WRAP53. By virtue of the primer, the mutation of the whole exon of the WRAP53 gene in the patient with the dyskeratosis congenital can be rapidly detected. A detection result finished by virtue of the primer is accurate, and the mutation condition of the whole exon sequence of the WRAP53 gene in the patient with the dyskeratosis congenital can be rapidly detected, so that the primer has important reference significances on the early intervention and the early treatment.

Description

technical field [0001] The invention relates to the fields of life science and biotechnology, in particular to primers for detecting WRAP53 gene mutations and applications thereof. Background technique [0002] Dyskeratosis congenital (dyskeratosis eongenita, DC) is a bone marrow failure syndrome with genetic heterogeneity, with an incidence of about 1 / 1 million. About 80% to 90% of typical DC patients have the triad of abnormal skin and mucous membranes, which are manifested as reticular pigmentation of the skin, atrophy of the finger (toe) nails, and leukoplakia of the oral mucosa. At present, the mutated genes reported in the literature that can cause DC mainly include CTC1, DKC1, TERC, TERT, TINF2, NHP2, NOP10 and WRAP53. It has been reported in the literature that these genes have three modes of inheritance, which are X-linked recessive inheritance, autosomal dominant inheritance, and autosomal recessive inheritance. However, the genetic characteristics of about 50% o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
15 Feb 2017
Publication
CN106399567A
IPC
C12Q1/68; C12N15/11
CPC
C12Q1/6883; C12Q2600/156
Inventors
单战; 陈奕磊