Supercharge Your Innovation With Domain-Expert AI Agents!

Preparing and identification method for chrysanthemum CmACO gene monoclonal antibodies

A technology of monoclonal antibody and chrysanthemum, applied in the field of bioengineering, can solve the problems of key enzyme preparation and functional blank

Inactive Publication Date: 2017-03-08
ZHENGZHOU NORMAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are still few reports on the role of ethylene in the rooting process of chrysanthemum, and the antibody preparation and functional research of key enzymes in its synthetic pathway are still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparing and identification method for chrysanthemum CmACO gene monoclonal antibodies
  • Preparing and identification method for chrysanthemum CmACO gene monoclonal antibodies
  • Preparing and identification method for chrysanthemum CmACO gene monoclonal antibodies

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0046] Provided is a method for preparing a chrysanthemum CmACO gene monoclonal antibody, comprising the following steps:

[0047] Step 1, preparing and sequencing the chrysanthemum CmACO gene;

[0048] Step 2, finding the antigenic fragment from the amino acid sequence of the chrysanthemum CmACO gene, and synthesizing the chrysanthemum CmACO antigenic protein;

[0049] Step 3: immunize experimental animals with the chrysanthemum CmACO antigen protein, and take animal cells to fuse with myeloma cells and coat with antigens to obtain hybridoma cell lines.

[0050] Step 4: The hybridoma cell line is proliferated, purified and screened to obtain the monoclonal antibody of the chrysanthemum CmACO gene.

[0051] What needs to be understood is that a gene (genetic element) is a DNA segment that has a genetic effect (some viruses such as tobacco mosaic virus and HIV have genetic material that is RNA). Genes support the basic structure and performance of life. It stores all the inf...

Embodiment

[0106] 1. According to the chrysanthemum EST database information, design a pair of primers:

[0107] CmACOF: GAACCTGAGAACAA TGGAAACCTT

[0108] CmACOR: CAAGACACCAGACCGATAAT

[0109] The target fragment was obtained by RT-PCR and sequenced.

[0110] 2. Using the amino acid sequence translated by CmACO ORF as the material, various methods in DNAStar were used to predict the epitope of the antigen cell.

[0111] The epitope map can comprehensively display the epitope index of each region in the target protein and the selected epitope, and the X-axis is the starting position of each 10 peptides in the target protein. The Y axis is the epitope index score. The higher the score, the more likely the 10-peptide is a successful epitope. The gray curves are the score curves for each 10 peptides. Blue indicates the selected 10-peptide fragments. The short bars on the X-axis represent the distribution of hydrophilicity in the target protein: green represents hydrophilicity, and red...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparing and identification method for chrysanthemum CmACO gene monoclonal antibodies. The preparing method for the chrysanthemum CmACO gene monoclonal antibodies includes the steps that 1, chrysanthemum CmACO genes are prepared and sequenced; 2, antigenic segments are found in the amino acid sequence of the chrysanthemum CmACO genes, and chrysanthemum CmACO antigen protein is synthesized; 3, experimental animals are immunized through the chrysanthemum CmACO antigen protein, animal cells and myeloma cells are fused and coated with the antibodies, and hybridoma cell strains are obtained; 4, the hybridoma cell strains are proliferated, purified and screened, and the chrysanthemum CmACO gene monoclonal antibodies are obtained. The influence of ethylene on generation of adventitious roots has the inhibiting effect and the promoting effect under the specific concentration; ACO is an important rate-limiting enzyme of ethylene biosynthesis, theory references are provided for researching cloning of the chrysanthemum CmACO genes and monoclonal antibody preparing and identifying plant propagation difficult to root, and technical supports are provided for quickening plant rooting of cutting on production and increasing the survival rate.

Description

technical field [0001] The invention relates to the field of bioengineering, more specifically, to a method for preparing and identifying a monoclonal antibody of the chrysanthemum CmACO gene. Background technique [0002] Chrysanthemum is the perennial root herbaceous plant that is Compositae, Chrysanthemum in Plant Taxonomy. According to the cultivation form, it can be divided into multi-headed chrysanthemum, solitary chrysanthemum, dali chrysanthemum, cliff chrysanthemum, art chrysanthemum, desk chrysanthemum and other cultivation types; according to the appearance of petals, it can be divided into garden embrace, retreat embrace, reverse embrace, random embrace, and open heart Bao, Feiwu Bao and other cultivation types. The chrysanthemums in different types are named various species names again. [0003] Chrysanthemum is China's ten large famous flowers the third, one of four gentleman (plum blossom, orchid, bamboo and chrysanthemum) in spending, and one of large cut-f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/40G01N33/68
CPCC07K16/40G01N33/6854
Inventor 刘瑞霞刘宇邈赵齐乔丹乔燕歌
Owner ZHENGZHOU NORMAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More