Over-expression GhJAZ1 genes capable of enhancing low temperature stress resistance of plants
A low temperature stress and overexpression technology is applied in the application field of GhJAZ1 gene in enhancing plant low temperature stress resistance, which can solve the problems of cotton planting effects, low temperature and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Isolation, cloning and expression pattern analysis of GhJAZ1 gene
[0043] A. RNA extraction and cDNA acquisition
[0044] The ORF, protein sequence and conserved domain of GhJAZ1 gene were obtained from NCBI (http: / / www.ncbi.nlm.nih.gov / gorf / gorf.html). Total RNA was extracted from Yuzao No. 1 upland cotton (YZ1) plant leaves, and the method of extracting total RNA was referred to the method reported by Zhu et al (2005). 2ug RNA samples were taken, and reverse transcriptase Superscript III (purchased from Invitrogen Company, U.S.) reverse-transcribed it to synthesize cDNA, and the reaction conditions were: 65° C. for 5 minutes, 50° C. for 60 minutes, and 70° C. for 10 minutes.
[0045] B. Obtaining the full-length sequence of GhJAZ1 gene
[0046] According to the ORF sequence of the GhJAZ1 gene obtained from the query, the primers GhJAZ1-F (5'-GAGCAAATAGTTGGGATTCTGG-3') and GhJAZ1-R (5'-AACTCGGCTGGGACTACTAC-3') were designed to amplify the gene, and PCR was...
Embodiment 2
[0049] Embodiment 2: Construction of GhJAZ1 gene plant overexpression vector and interference expression vector
[0050] A. Construction of overexpression vector
[0051] According to the obtained gene sequence, primers with BP-LR reaction adapters were designed to construct expression vectors. The primer sequences were OE-GhJAZ1-F (5'-GGGGACAAGTTTGTACAAAAAGCAGGCTGCGAGCAAATAGTTGGGATTCTGG-3') and OE-GhJAZ1-R (5'- GGGGACCACTTTGTACAAGAAAGCTGGGTCAACTCGGCTGGGACTACTAC-3'), T-GhJAZ1 plasmid (purchased from Promega, USA) was used as a template for PCR amplification. 1 cycle; 72°C extension for 5 min, amplified by PCR to obtain a PCR product containing the complete ORF with linker bases of BP-LR reaction at both ends. The PCR product was ligated into pDONR by BP reaction TM 221 carrier (BP enzyme was purchased from Invitrogen Company, the United States, reacted at room temperature for 4 hours, pDONR TM 221 carrier map see Figure 3C , pDONR TM 221 vector (from CSIRO Plant Industry...
Embodiment 3
[0057] Genetic transformation and screening identification of embodiment 3GhJAZ1 gene
[0058] A. Preparation of Cotton Hypocotyls
[0059] The test material was Yuzao No. 1 upland cotton (YZ1). The plump and consistent YZ1 seeds were selected, the seed coat was peeled off, and sterilized with 0.1% mercury chloride solution for 10-12 minutes. During this period, the seeds were rinsed with sterile water three times. Seeds were placed on the surface of MS medium. After 1 day of dark culture at 30°C, seedlings were supported, and dark culture was continued for 4-5 days.
[0060] B. Activation of Agrobacterium
[0061] Take out the glycerol tube of the EHA105 strain containing the target gene (i.e. the cloned GhJAZ1 gene of the present invention) stored in the ultra-low temperature refrigerator and melt it on ice, add 10 μl to 2 ml of LB liquid containing 100 mg / L spectinomycin, and culture with shaking at 28°C 1 day, add 20ul of the activated bacteria solution and 15-20ml of f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


