A kind of recombinant bacteria producing alkaline pectinase and its application

A pectinase and alkaline technology, applied in the field of genetic engineering, can solve the problems of low expression level, the yield of alkaline pectinase cannot be further improved, and the industrial production of alkaline pectinase is restricted, and the effect of high expression is achieved.

Active Publication Date: 2019-03-15
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the production of alkaline pectinase can be effectively increased by means of fermentation optimization, etc., when it reaches a certain limit, the production of alkaline pectinase cannot be further improved, which limits the industrial production of alkaline pectinase, so it is necessary to solve the limitation from the source Factors of Alkaline Pectinase Expression
[0004] Although the Pichia pastoris host has the advantages of expressing protein and being easy to purify, when the current alkaline pectinase is expressed in Pichia pastoris, the expression level is not high or the original nucleotide sequence of the foreign gene is not very suitable for Pichia pastoris. The host problem of red yeast, which limits the high-efficiency expression of alkaline pectinase in Pichia pastoris, the glycosylation phenomenon in the yeast eukaryotic expression system has a great impact on the high-efficiency expression and properties of alkaline pectinase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of recombinant bacteria producing alkaline pectinase and its application
  • A kind of recombinant bacteria producing alkaline pectinase and its application
  • A kind of recombinant bacteria producing alkaline pectinase and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Construction of embodiment 1 recombinant bacteria Pichia pastoris GS115 / N185Q

[0042] Using the gene K314Mopt (application number 201610170070.0, published in the patent application on July 13, 2016) as the starting control gene, the alkaline pectinase gene PGL / N185Q, then design primers, obtain the alkaline pectinase gene N185Q (sequence shown in SEQ ID NO.1) by PCR method, clone it into the expression vector pPIC9K, obtain the recombinant plasmid pPIC9K-N185Q, transform the recombinant vector Pichia pastoris GS115, the recombinant strain Pichia pastoris GS115-pPIC9K-N185Q was obtained after screening and identification.

[0043] Primers are as follows:

[0044] PGL-F: GCTGAAGCTTACGTAGAATTCGCTGATTTGGGTCATCAAACACTTG

[0045] PGL-R: AAGGCGAATTAATTCGCGGCCGCTTAGTTCAATTTTCCAGCACCTGCT

[0046] The gene was transferred into Pichia pastoris cells by electroporation. The specific steps are as follows: Pick a single colony of yeast recipient bacteria and inoculate it in 25...

Embodiment 2

[0047] Example 2 Construction of Pichia pastoris GS115 / N185Q-ERO1-UBC1

[0048] Extract Pichia pastoris RNA, reverse transcribe it into cDNA, use cDNA as a template, design primers, obtain ERO1 and UBC1 genes by PCR, clone them into the expression vector pGAPZA, and obtain recombinant plasmids pGAPZA-ERO1 and pGAPZA-UBC1, Then construct the co-expression vector pGAPZA-ERO1-UBC1 based on the isotail enzyme effect of BglⅡ and BamHI (the schematic diagram of cloning expression plasmid is shown in the appendix figure 1 ), the recombinant vector pGAPZA-ERO1-UBC1 was transformed into Pichia pastorisGS115-pPIC9K-N185Q (prepared in Example 1), and the co-expression recombinant strain Pichia pastorisGS115 / N185Q-ERO1-UBC1 was obtained through screening and identification.

[0049] Primers are as follows:

[0050]

[0051] The transformation of Pichia pastoris was performed by electroporation.

[0052] The specific steps are as follows: Pick a single colony of yeast recipient bacter...

Embodiment 3

[0053] Embodiment 3 co-expression genetic engineering strain shake flask fermentation culture

[0054] Cultivation method: After seed activation, the strain was inoculated into the basic fermentation medium YPD, cultured at 30°C and 220rpm for 14h, then transferred to the optimized growth medium BMGY and cultured at 30°C and 220rpm for 24h, and then the strain Transfer to the induction medium BMMY at 22-28°C, 220rpm and add methanol at a final concentration of 10-20mL / L every 24h to induce the expression of alkaline pectinase.

[0055] Select Beyontian SDS-PAGE gel electrophoresis kit to prepare 12% separating gel and 5% stacking gel. For specific operation methods, please refer to the product manual. The sample was mixed with 5× loading buffer at a volume ratio of 4:1, boiled in water bath for 10 min, and loaded after cooling. During electrophoresis, the constant voltage is 80V. After the indicator enters the separation gel, the voltage is adjusted to 150V, and the electroph...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Belonging to the technical field of genetic engineering, the invention discloses a recombinant strain producing alkaline polygalacturonate lyase (PGL) and application thereof. By means of gene recombination technology, the ERO1 and UBC1 gene of pichia pastoris are combined, cloned and connected to a pichia pastoris expression vector pPGAZA, and are transformed into a GS115 / N185Q strain, thus obtaining a GS115 / N185Q-ERO1-UBC1 strain highly-expressing alkaline polygalacturonate lyase than the original strain, during shaking flask fermentation, compared with the strain GS115 / N185Q before use of the method, the enzyme activity is increased by 54.2%, and after fermentation culture in a 3L fermentation tank, the maximum enzyme activity can reach 5485.68U / mL, which is the maximum yield of PGL reported in the literature currently, and the recombinant strain realizes efficient expression of alkaline polygalacturonate lyase.

Description

technical field [0001] The invention relates to a recombinant bacterium producing alkaline pectinase and its application, belonging to the technical field of genetic engineering. Background technique [0002] Pectinase is a complex enzyme that breaks down pectin polymers into unsaturated oligogalacturonic acids. The enzyme is widely distributed and found in some parasitic nematodes, plants and microorganisms. Pectinase is widely used and has a history of industrial application for more than 40 years. According to the optimal reaction pH, pectinase can be divided into acid pectinase and alkaline pectinase (Alkaline Polygalacturonate Lyase, PGL). Among them, acid pectinase is mainly used in clarification of fruit juice and wine, extraction of fruit and vegetable juice, fruit peeling and so on. PGL applications are mainly used in textile, food, paper industry and environmental fields. The application of enzymatic method to the above-mentioned field-related reactions has the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/19C12N15/81C12N9/88C12R1/84
CPCC12N9/88C12N15/815C12Y402/02002
Inventor刘松陈双全任立均陈坚堵国成
OwnerJIANGNAN UNIV