A method for identification of sea bream germplasm and its application
A sea bream germplasm technology, applied in the field of molecular biology, can solve problems such as production performance decline, germplasm degradation, sea bream germplasm mixing, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Primer A Feasibility Analysis
[0030] 10 red sea bream and 10 black sea bream with confirmed germplasm, 9 orthogonal offspring (red sea bream ♀ × black sea bream ♂), 6 reciprocal offspring (black sea bream ♀× red sea bream ♂), a total of 35 samples, from Jiangsu Collected from Lvsi Base of Provincial Oceanic and Fisheries Research Institute.
[0031] Genomic DNA was extracted from 30 μL of blood cells from each fish, and the extracted genomic DNA was used as a template for PCR amplification. The sense primer sequence of primer A is: 5'AACACTTATCGCACGGCTCAG3', the antisense primer sequence is: 5'CCCTCTGAGATCTTCACCTCCA 3'; the total volume of the PCR system is 20 μL, which contains 2 μL of 10× reaction buffer, Mg 2+ 2mmol / L, dNTP 200μmol / L, upstream and downstream primers 0.2μmol / L, Taq enzyme 0.5U, DNA template 100ng~200ng, make up the volume to 20μL with sterile double distilled water. The PCR reaction conditions were: 94°C for 2min; 94°C for 30s, 30 cycles...
Embodiment 2
[0033] Example 2 Primer B Combined with Enzyme Digestion Feasibility Analysis
[0034] 12 orthographic progenies (red bream ♀ × black bream ♂) and 11 reciprocal progenies (black bream ♀ × red bream ♂) were identified, and a total of 23 samples were collected from Lvsi base of Jiangsu Institute of Oceanography and Fisheries .
[0035] Genomic DNA was extracted from 30 μL of blood cells from each fish, and the extracted genomic DNA was used as a template for PCR amplification. The sense primer sequence of primer B is: 5′GCATAACACTGAAGCTGTTAAGATGG3′, the antisense primer sequence is: 5′CAATGTTTATCACTGCTGAGTACCCT 3′; the total volume of the PCR system is 20 μL, which contains 2 μL of 10× reaction buffer, Mg 2+ 2mmol / L, dNTP 200μmol / L, upstream and downstream primers 0.2μmol / L, Taq enzyme 0.5U, DNA template 100ng~200ng, make up the volume to 20μL with sterile double distilled water. The PCR reaction conditions were: 94°C for 2min; 30 cycles of 94°C for 30s, annealing at 55°C for ...
Embodiment 3
[0036] Embodiment 3 sea bream germplasm identification
[0037] 12 red breams, 10 black breams, and 15 hybrid red breams and black breams to be inspected were collected from the Lvsi Base of the Jiangsu Provincial Institute of Marine Fisheries.
[0038] The caudal fin of each fish was clipped and genomic DNA was extracted, and the method as described in Example 1 was used for PCR amplification and electrophoresis detection. Such as image 3 As shown, there is a band of 255bp in the red sea bream, a band of 271bp in the black sea bream, and 2 bands in the hybrid sea bream and black sea bream, respectively 255bp and 271bp, and 12 detected Red sea bream and 10 black sea bream are all purebred, no germplasm mixed.
[0039] The 15 hybrid breams were then amplified by PCR using the method described in Example 2, detected, and digested again, and the digested products were electrophoresed with 3% agarose to take pictures and record the electrophoresis results. Such as Figure 4 A...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com