Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for identification of sea bream germplasm and its application

A sea bream germplasm technology, applied in the field of molecular biology, can solve problems such as production performance decline, germplasm degradation, sea bream germplasm mixing, etc.

Inactive Publication Date: 2019-09-13
FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In production, the external form of the hybrid is very similar to that of the parent, and the offspring of the orthogonal cross and the offspring of the reverse cross are also easily confused. Therefore, it is easy to cause the germplasm of sea bream to be mixed in production, resulting in a decline in production performance and germplasm degradation.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for identification of sea bream germplasm and its application
  • A method for identification of sea bream germplasm and its application
  • A method for identification of sea bream germplasm and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Primer A Feasibility Analysis

[0030] 10 red sea bream and 10 black sea bream with confirmed germplasm, 9 orthogonal offspring (red sea bream ♀ × black sea bream ♂), 6 reciprocal offspring (black sea bream ♀× red sea bream ♂), a total of 35 samples, from Jiangsu Collected from Lvsi Base of Provincial Oceanic and Fisheries Research Institute.

[0031] Genomic DNA was extracted from 30 μL of blood cells from each fish, and the extracted genomic DNA was used as a template for PCR amplification. The sense primer sequence of primer A is: 5'AACACTTATCGCACGGCTCAG3', the antisense primer sequence is: 5'CCCTCTGAGATCTTCACCTCCA 3'; the total volume of the PCR system is 20 μL, which contains 2 μL of 10× reaction buffer, Mg 2+ 2mmol / L, dNTP 200μmol / L, upstream and downstream primers 0.2μmol / L, Taq enzyme 0.5U, DNA template 100ng~200ng, make up the volume to 20μL with sterile double distilled water. The PCR reaction conditions were: 94°C for 2min; 94°C for 30s, 30 cycles...

Embodiment 2

[0033] Example 2 Primer B Combined with Enzyme Digestion Feasibility Analysis

[0034] 12 orthographic progenies (red bream ♀ × black bream ♂) and 11 reciprocal progenies (black bream ♀ × red bream ♂) were identified, and a total of 23 samples were collected from Lvsi base of Jiangsu Institute of Oceanography and Fisheries .

[0035] Genomic DNA was extracted from 30 μL of blood cells from each fish, and the extracted genomic DNA was used as a template for PCR amplification. The sense primer sequence of primer B is: 5′GCATAACACTGAAGCTGTTAAGATGG3′, the antisense primer sequence is: 5′CAATGTTTATCACTGCTGAGTACCCT 3′; the total volume of the PCR system is 20 μL, which contains 2 μL of 10× reaction buffer, Mg 2+ 2mmol / L, dNTP 200μmol / L, upstream and downstream primers 0.2μmol / L, Taq enzyme 0.5U, DNA template 100ng~200ng, make up the volume to 20μL with sterile double distilled water. The PCR reaction conditions were: 94°C for 2min; 30 cycles of 94°C for 30s, annealing at 55°C for ...

Embodiment 3

[0036] Embodiment 3 sea bream germplasm identification

[0037] 12 red breams, 10 black breams, and 15 hybrid red breams and black breams to be inspected were collected from the Lvsi Base of the Jiangsu Provincial Institute of Marine Fisheries.

[0038] The caudal fin of each fish was clipped and genomic DNA was extracted, and the method as described in Example 1 was used for PCR amplification and electrophoresis detection. Such as image 3 As shown, there is a band of 255bp in the red sea bream, a band of 271bp in the black sea bream, and 2 bands in the hybrid sea bream and black sea bream, respectively 255bp and 271bp, and 12 detected Red sea bream and 10 black sea bream are all purebred, no germplasm mixed.

[0039] The 15 hybrid breams were then amplified by PCR using the method described in Example 2, detected, and digested again, and the digested products were electrophoresed with 3% agarose to take pictures and record the electrophoresis results. Such as Figure 4 A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a snapper germplasm identification method and an application thereof. Two pairs of specific primers are adopted for performing amplification successively, and pagrosomus major, sparus macrocephalus and reciprocal cross offsprings of the pagrosomus major and the sparus macrocephalus are identified in combination with an enzyme digestion method. According to the method, the germplasm of snapper can be quickly and accurately identified in molecular level; and the pagrosomus major, the sparus macrocephalus and the reciprocal cross offsprings of the pagrosomus major and the sparus macrocephalus can be clearly identified, and an important basis is provided for breed identification, germplasm resource protection, breeding and the like of the snapper.

Description

technical field [0001] The invention belongs to the field of molecular biology and relates to a fish molecular marker breeding method, in particular to a sea bream germplasm identification method and application thereof. Background technique [0002] The red sea bream Pagrosomus major belongs to Perciformes, Bremidae, and Red Seabream, and the black sea bream Spraus macrocephalus belongs to Perciformes, Bremidae, and Black Sea bream. They are important economic fishes for marine aquaculture in my country. Red sea bream has the characteristics of large body, fast growth, good meat quality, beautiful color, and strong disease resistance, but it is sensitive to changes in salinity and temperature and has poor stress resistance; black sea bream has a wide range of adaptability to temperature and salinity, but It grows slowly and takes a long time to grow. Through the hybrid breeding of red sea bream and black sea bream, hybrid offspring with excellent traits of both parents can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/686
Inventor 李建林徐跑张志勇俞菊华李红霞唐永凯张志伟于凡
Owner FRESHWATER FISHERIES RES CENT OF CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com