Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group, probe and kit for kawasaki disease detection

A Kawasaki disease and probe sequence technology, applied in the biological field, can solve problems affecting the specificity of detection results and achieve accurate results

Active Publication Date: 2017-05-24
湖南赛哲智造科技有限公司
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] The principle of fluorescent quantitative PCR using ordinary dye method utilizes the characteristics that nucleic acid double-stranded DNA molecules can combine with multi-molecular dyes and excite fluorescence under specific conditions. Its detection sensitivity is extremely high, but primer dimers, single-stranded secondary structures and non-specific Amplified products may affect the specificity of the test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group, probe and kit for kawasaki disease detection
  • Primer group, probe and kit for kawasaki disease detection
  • Primer group, probe and kit for kawasaki disease detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Reverse transcription primer, amplification primer and probe sequence for detecting Kawasaki disease

[0065] The detection markers for Kawasaki disease are: hsa-miR-197, hsa-miR-671, hsa-miR1246 and hsa-miR4436.

[0066] The reverse transcription primer sequence is:

[0067] RT-miR197:

[0068] G TCGTATCCAGTGCAGGG T CCGAGGTATTCGCACTGGATA CGACGCTGGG;

[0069] RT-miR671:

[0070] G TCGTATCCAGTGCAGGG T CCGAGGTATTCGCACTGGATA CGACTTTTTTTTTTTCTCCAGCC;

[0071] RT-miR1246:

[0072] G TCGTATCCAGTGCAGGG T CCGAGGTATTCGCACTGGATA CGACCCTGCT;

[0073] RT-miR4436:

[0074] G TCGTATCCAGTGCAGGG T CCGAGGTATTCGCACTGGATA CGACGGCAGGGC;

[0075] The amplification primer sequence is:

[0076] Universal reverse primer R-KD: TCGTATCCAGTGCAGGG ;

[0077] F-miR197: TTCACCACCTTCTCCACC;

[0078] F-miR671: GAGAGGAAGCCCTGGAG;

[0079] F-miR1246: GCCGAATGGATTTTTGGAG;

[0080] F-miR4436: TCCTGTCCACTTCTGCCT;

[0081] The probe sequence is: CCGAGGTATTCGCACTGGAT .

[0082] In the above primer sequence, the...

Embodiment 2

[0083] Example 2 Detection method of Kawasaki disease

[0084] (1) Extraction of serum exosomal miRNA

[0085] The operation of extracting serum exosomal miRNA includes the following steps:

[0086] 1) Place 250μl of serum on ice to dissolve naturally, then add 60μl of exosome extraction reagent, gently pipette to mix, then let stand on ice for 30min; centrifuge at 1500g at 4℃ for 10min; remove as much as possible with a pipette All the supernatant and the precipitation part are exosome;

[0087] 2) Add 1ml Trizol to the exosome extracted above to fully lyse (ultrasound and mix well), and let it stand for 5 minutes;

[0088] 3) Add 200μl of chloroform, shake and mix well for about 30s, make the water phase and organic phase fully contact, and let it stand at room temperature for about 10min;

[0089] 4) Centrifuge at 14000g for 15min at 4℃, and transfer RNA in the upper water phase to another new Rnase-free EP tube;

[0090] 5) Add an equal volume of isopropanol, mix gently and thoroughl...

Embodiment 3

[0124] Example 3 Specificity evaluation experiment

[0125] There are 8 Kawasaki disease-specific miRNAs: miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, miR-134 in serum exosome of Kawasaki disease patients and healthy people There is a significant difference between the medium and the average, which may affect the detection specificity of the primers and probes of the present invention.

[0126] Respectively use miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, miR-13410nM standard cDNA after reverse transcription as a template, using the above example 1 and The primers, probes and methods described in 2 were tested and verified 8 miRNAs specific to Kawasaki disease: miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, Whether miR-134 can be amplified.

[0127] The experimental results are as figure 1 Shown. figure 1 Among them, curves A~H are respectively miR-4739, miR-16, miR-483, miR-21, miR-19, miR-22, miR-1260, miR-134 10nM standard cDNA Q- P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a primer group, probe and kit for kawasaki disease detection. The primer group comprises a reverse transcription primer, an amplification primer and a probe sequence. A nucleic acid sequence combination can effectively qualitatively / quantitatively detect hsa-miR-197, hsa- miR-671, hsa-miR1246 and hsa-miR4436. Through the nucleic acid sequence and the kit and the like, reverse transcription can be performed on target miRNA effectively, positive samples and negative samples are distinguished better, detection results are judged more easily, and obtained results are more accurate.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and relates to a primer set, probe and kit for detecting Kawasaki disease. Background technique [0002] Kawasaki disease (Kawasaki disease KD) is an acute febrile systemic vasculitis syndrome of unknown etiology. The disease was first discovered in Japan by Japanese scholar Tomisaku Kawasaki in 1961 and first reported in 1967. Since 1970, KD has been reported in most countries or regions in the world, with the highest incidence among Asians. In recent years, KD has become one of the common diseases in children. KD mainly affects infants under 5 years of age. The clinical features are fever, mucositis, skin rash, cervical lymphadenopathy and acral changes. The pathological changes are mainly systemic arterial vasculitis, especially It is easy to cause inflammatory injury of coronary arteries and the formation of thrombotic infarction, stenosis, dilation and aneurysm. Some of these children develop huge ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/178
Inventor 曾宏彬陈杰罗宝花余旻斐
Owner 湖南赛哲智造科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com