Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A kind of RNAi and its application in the preparation of drugs for treating liver cancer

A technology for drug and tumor treatment, applied in the field of RNAi sequences, can solve the problems of poor efficacy and low effective rate of targeted drugs, and achieve the effect of reducing invasiveness

Active Publication Date: 2019-07-12
GENERAL HOSPITAL OF CHINESE PEOPLES ARMED POLICEFORCES
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since most patients with liver cancer in our country are in the middle and late stages when they are diagnosed, most of them are accompanied by liver cirrhosis, the surgical resection rate is less than 30%, and the postoperative recurrence rate is as high as 70%. Low, there is currently no effective drug for the treatment of liver cancer

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of RNAi and its application in the preparation of drugs for treating liver cancer
  • A kind of RNAi and its application in the preparation of drugs for treating liver cancer
  • A kind of RNAi and its application in the preparation of drugs for treating liver cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Preparation and screening of embodiment 1 RNAi

[0035] 1. Target gene selection and RNAi design

[0036] A total of 4 target sequences to be interfered were selected for the MPPE1 gene, and the information is shown in Table 1.

[0037] Table 1. Four target sequences and one negative control sequence against MPPE1

[0038] Numbering gene name target sequence 6192 MPPE1-homo-1459 GCGTCCCATTCTTTCAGTTGGA 6193 MPPE1-homo-1656 GGTTTGAACTTGCTCGGAAAG 6194 MPPE1-homo-1667 GCTCGGAAAGCGTAAGACAAG 6195 MPPE1-homo-1169 GCTTCCATTATGAGATGAACA 6196 wxya TTCTCCGAACGTGTCACGT

[0039] shNC is the negative control sequence

[0040] 2. Design and synthesize RNAi sequences for the above four target sequences

[0041] DNA oligo was designed using Designer3.0 (Genepharma) software, and DNA oligo was synthesized by conventional gene synthesis technology.

[0042] Design Principles:

[0043] The loop structure in the LV3-shRNA templa...

Embodiment 2

[0141] Example 2 Cell flow cytometry detection of apoptosis caused by RNAi

[0142] 1. Experimental materials and reagents:

[0143] (1) AnnexinV-PE / 7-AAD Apoptosis Detection Kit (KGA1017)

[0144] (2) BD FACS Calibur flow cytometer

[0145] 2. Steps:

[0146] (1) After the cells of each group were subcultured for 48 hours, the cells were digested with EDTA-free trypsin, collected by centrifugation, and the speed of the microcentrifuge was 2000 RPM for 5 minutes, and the culture medium was discarded.

[0147] (2) Wash the cells twice with cold PBS (2000 RPM, centrifuge for 5 minutes to collect the cells).

[0148] (3) Add 5ul of 7-AAD staining solution to 50ul of Binding Buffer and mix well.

[0149] (4) Add the above-mentioned 7-AAD staining solution to the collected cells, mix well; react at room temperature for 15 minutes in the dark.

[0150] (5) After the reaction, add 450ul of Binding Buffer and mix well; add 1ul Annexin V-PE and mix well, and react at room temperat...

Embodiment 3

[0157] Example 3 Application of CCK8 Kit to Detect the Effect of RNAi on Cell Proliferation

[0158] 1. Cells in each group were subcultured overnight, discarded the culture medium, and washed the cells twice with 3ml PBS.

[0159] 2. Add 1ml Trypsin-EDTA solution, mix well, carefully suck off the trypsin solution, and place at 37°C for 3 minutes

[0160] 3. Add 6ml of culture medium containing 10% FBS, and pipette the cells to form a single-cell suspension.

[0161] 4. Count on a hemocytometer and dilute the cells to 5×10 5 cells / ml.

[0162] 5. Press 3×10 3Inoculate the 96-well plate at the concentration of cells / well, and set the zero-adjustment group at the same time, that is, directly add 100 μl DMEM medium to the well, set 5 repetitions for each group, mix well and store in 37°C 5% CO 2 to cultivate.

[0163] 6. At 0, 24, 48, 72, and 96 hours, pour out the culture medium, add 100 μl of fresh medium, add 10 μl of CCK8 to each well in the dark, and incubate in the dar...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RNAi [RNA (ribonucleic acid) interference] sequence for specific segments of MPPE1 (metallophosphoesterase 1) genes, a vector with the RNAi sequence, a slow virus, a medicine composition and application of the RNAi sequence to preparing medicines for treating hepatocellular carcinoma. The RNAi sequence, the vector, the slow virus, the medicine composition and the application have the advantages that expression of the MPPE1 genes can be effectively suppressed by the RNAi sequence; G2 phases of the cell growth cycle can be changed after the RNAi sequence interferes with the MPPE1 genes in hepatocellular carcinoma cells, the proliferation capacity, the migration capacity and the invasiveness of the cells can be obviously deteriorated, cell apoptosis occurs, and accordingly a prospect of applying the RNAi sequence to preparing the medicines for treating the hepatocellular carcinoma is indicated.

Description

technical field [0001] The invention discloses an RNAi sequence and belongs to the technical field of molecular biology. Background technique [0002] The incidence of hepatocellular carcinoma (HCC, referred to as liver cancer) in my country ranks first in the world. According to statistics, the annual incidence of liver cancer in the world is about 700,000, China accounts for 1055%, and the mortality rate accounts for 45% of the world. Since most patients with liver cancer in our country are in the middle and late stages when they are diagnosed, most of them are accompanied by liver cirrhosis, the surgical resection rate is less than 30%, and the postoperative recurrence rate is as high as 70%. Low, there is currently no effective drug for the treatment of liver cancer. The research and development of anti-liver cancer drugs is currently a global research hotspot. [0003] MPPE1 (Metallophosphoesterase1) is a protein-coding gene, and the protein encoded by it is a metal-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85C12N5/10C12N7/01A61K48/00A61K31/7088A61P35/00
CPCC12N5/0636C12N7/00C12N15/1137C12N15/85C12N2310/14C12N2510/00C12N2740/15051C12N2800/107
Inventor 张庆陈新国沈中阳王培晓陈虹
Owner GENERAL HOSPITAL OF CHINESE PEOPLES ARMED POLICEFORCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com