A kind of anti-insect fusion gene, encoded protein and application thereof
A fusion gene and fusion protein technology, applied in the direction of anti-enzyme immunoglobulin, anti-bacterial immunoglobulin, etc., to achieve the effect of expanding insecticidal spectrum, broad insecticidal spectrum, and delaying the occurrence of pest resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1, the construction of Tma12-Vip3A fusion protein expression vector
[0029] The genes of Tma12 and Vip3A insecticidal proteins were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 7 in Chinese patent 200610049611.0, and cloned in the restriction endonuclease BamHI of the pET28a expression vector and SacI site between. The constructed vectors were named pET28a-Tma12 and pET28a-Vip3A respectively.
[0030] The specific steps of Tma12-Vip3A synthesis are as follows:
[0031] 1. Using Vip3A (SEQ ID NO: 7 in Chinese patent 200610049611.0) as a template to obtain the Vip3A gene fragment by PCR.
[0032] 2. The primers are:
[0033] Vip3A-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R: 5'CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.
[0034] 3. The PCR product was treated with XmaI and ScaI, and ligated with the pET28a-Tma...
Embodiment 2
[0036] Embodiment 2, construction of Tma12-Vip3H fusion protein expression vector
[0037] The genes of Tma12 and Vip3H insecticidal proteins were synthesized by Shanghai Sangong, and their DNA sequences were respectively SEQ ID NO: 5 and SEQ ID NO: 6, and were cloned between the restriction endonuclease BamHI and SacI sites of the pET28a expression vector between. The constructed vectors were named pET28a-Tma12 and pET28a-Vip3H respectively.
[0038] The specific steps of Tma12-Vip3H synthesis are as follows:
[0039]1. Using Vip3H (SEQ ID NO: 6) as a template to obtain a Vip3H gene fragment through PCR. The primers were: Vip3H-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R: 5'CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.
[0040] 2. The PCR product was treated with XmaI and ScaI, and ligated with the pET28a-Tma12 vector treated with the same enzymes.
[0041] 3. Transform i...
Embodiment 3
[0042] Embodiment 3, the expression of insecticidal protein
[0043] General standard method The above-mentioned expression vectors containing the fusion protein gene (pET28a-Tma12-Vip3A, pET28a-Tma12-Vip3H, pET28a-Tma12, pET28a-Vip3A and pET28a-Vip3H) were respectively transformed into Escherichia coli BL21star. Pick a monoclonal colony and inoculate it into 100ml LB bacterial culture medium, shake and cultivate to OD at 37°C 600 =0.6, add IPTG to 0.5mM, and continue to incubate under the same conditions for 4 hours. The collected culture solution was centrifuged at 5000 g for 10 minutes to precipitate E. coli cells, and then the supernatant was discarded to collect the precipitate. Add 30 ml of 20mM Tris-HCL buffer solution to the precipitate and ultrasonically pulverize it for the determination of insecticidal activity.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



