Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of anti-insect fusion gene, encoded protein and application thereof

A fusion gene and fusion protein technology, applied in the direction of anti-enzyme immunoglobulin, anti-bacterial immunoglobulin, etc., to achieve the effect of expanding insecticidal spectrum, broad insecticidal spectrum, and delaying the occurrence of pest resistance

Active Publication Date: 2020-05-29
ZHEJIANG UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still some problems in the actual operation and application of the above method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of anti-insect fusion gene, encoded protein and application thereof
  • A kind of anti-insect fusion gene, encoded protein and application thereof
  • A kind of anti-insect fusion gene, encoded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, the construction of Tma12-Vip3A fusion protein expression vector

[0029] The genes of Tma12 and Vip3A insecticidal proteins were synthesized by Shanghai Sangong, and their DNA sequences were SEQ ID NO: 5 and SEQ ID NO: 7 in Chinese patent 200610049611.0, and cloned in the restriction endonuclease BamHI of the pET28a expression vector and SacI site between. The constructed vectors were named pET28a-Tma12 and pET28a-Vip3A respectively.

[0030] The specific steps of Tma12-Vip3A synthesis are as follows:

[0031] 1. Using Vip3A (SEQ ID NO: 7 in Chinese patent 200610049611.0) as a template to obtain the Vip3A gene fragment by PCR.

[0032] 2. The primers are:

[0033] Vip3A-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACACCAAG and Vip3A-R: 5'CGAGCTCCTACTTGATGCTCACGTCGTAGAACTTCACGA. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.

[0034] 3. The PCR product was treated with XmaI and ScaI, and ligated with the pET28a-Tma...

Embodiment 2

[0036] Embodiment 2, construction of Tma12-Vip3H fusion protein expression vector

[0037] The genes of Tma12 and Vip3H insecticidal proteins were synthesized by Shanghai Sangong, and their DNA sequences were respectively SEQ ID NO: 5 and SEQ ID NO: 6, and were cloned between the restriction endonuclease BamHI and SacI sites of the pET28a expression vector between. The constructed vectors were named pET28a-Tma12 and pET28a-Vip3H respectively.

[0038] The specific steps of Tma12-Vip3H synthesis are as follows:

[0039]1. Using Vip3H (SEQ ID NO: 6) as a template to obtain a Vip3H gene fragment through PCR. The primers were: Vip3H-F: 5'CCCGGGAAGGGTGGAGGAATGAACAAGAACAACAGTAAG and Vip3H-R: 5'CGAGCTCCTACTTGATGCTGAAGTCCCTGAAGGTGATGT. These two primers contain restriction endonuclease sites XmalI and ScaI sites, respectively.

[0040] 2. The PCR product was treated with XmaI and ScaI, and ligated with the pET28a-Tma12 vector treated with the same enzymes.

[0041] 3. Transform i...

Embodiment 3

[0042] Embodiment 3, the expression of insecticidal protein

[0043] General standard method The above-mentioned expression vectors containing the fusion protein gene (pET28a-Tma12-Vip3A, pET28a-Tma12-Vip3H, pET28a-Tma12, pET28a-Vip3A and pET28a-Vip3H) were respectively transformed into Escherichia coli BL21star. Pick a monoclonal colony and inoculate it into 100ml LB bacterial culture medium, shake and cultivate to OD at 37°C 600 =0.6, add IPTG to 0.5mM, and continue to incubate under the same conditions for 4 hours. The collected culture solution was centrifuged at 5000 g for 10 minutes to precipitate E. coli cells, and then the supernatant was discarded to collect the precipitate. Add 30 ml of 20mM Tris-HCL buffer solution to the precipitate and ultrasonically pulverize it for the determination of insecticidal activity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an insect-resistant fusion gene and an encoded protein as well as application thereof. The gene comprises a nucleotide sequence of encoding chitin binding protein and a nucleotide sequence of encoding Vip3 toxin in turn from 5' to 3'. The two nucleotide sequences are located in one opening reading frame. Compared with original chitin binding protein and by Vip3 protein, the artificial protein molecule formed by fusing one chitin binding protein and one Vip3 toxin designed by the invention has the advantages that the insecticidal spectrum is wide, various important pests (such as beet armyworm, armyworm and mealywing) in lepidoptera and hemiptera can be simultaneously prevented and controlled and the insecticidal efficiency reaches up to 50%-100%; the combined utilization of the proteins with different functions and other insect-resisting proteins (such as ICPs) is benefited, the insecticidal spectrum is further widened, and the generation of pest resistance is delayed.

Description

[0001] (1) Technical field [0002] The invention relates to an insect-resistant fusion gene, a fusion protein encoded by the insect-resistant fusion gene, and applications of the fusion protein. [0003] (2) Background technology [0004] Pests have brought huge losses to global agricultural production. At present, pest control mainly relies on chemical pesticides, but the use of pesticides has increased production costs, and pesticide residues have caused serious harm to human health. Therefore, the use of genetic engineering methods to control pests has great economic, environmental and social value. [0005] The key to obtaining transgenic insect-resistant crops is to clone good insecticidal proteins. There are many insecticidal proteins, and the most widely used one is a kind of accompanying cell crystal protein (insecticidalcrystal proteins, ICP) secreted by Bacillus thuringiensis (Bt) during cell production, such as Cry1Ab, Cry1C, etc. Lepidoptera, Diptera, Coleoptera ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/62C07K19/00C12N15/82A01H5/00A01H6/46C12N1/21C07K16/40C07K16/12C12R1/19
CPCC07K14/325C07K16/1278C07K16/40C07K2319/00C12N9/2442C12N15/8286C12Y302/01014
Inventor 张先文王东芳沈志成
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com