Method for improving resistance of rice blast by using sucrose synthase
A rice blast and sucrose synthase technology, which is applied in the field of constructing transsucrose synthase gene rice, can solve the problems of rice blast resistance of plants without sucrose synthase.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] One, embodiment 1: the cloning of AtCESA8 promoter and OsSUS3 gene cDNA
[0035] The full-length AtCESA8 promoter was cloned from Arabidopsis thaliana with a length of 949bp. The cDNA of OsSUS3 gene was cloned from rice, the length was 2643bp, and the CDS was 2451bp. The PCR product was recovered, digested, and connected to the vector.
[0036] ——Using the genomic DNA of Arabidopsis thaliana as a template, primers were synthesized to amplify the AtCESA8 promoter.
[0037] F1: CCCAAGCTTCAGAGGAAACTCAGATGTGATGA;
[0038] R1: ACGCGTCGACCTTCGAATTCCCCTGTTTGGAGA;
[0039] ——Synthetic primers to amplify OsSUS3 cDNA
[0040] F2: ACGCGTCGACTTTCCTCCTCTTCTCCTTT;
[0041] R2: ACTGGCCCTGAAATCAAC
Embodiment 2
[0042] Two, embodiment 2: the construction of expression vector
[0043] 1. The construction of the OsSUS3 vector (pC1300T-AtCESA8-OsSUS3) overexpressing rice with the Arabidopsis AtCESA8 promoter (see image 3 ):
[0044] ——The promoter and the OsSUS3 cDNA sequence were respectively connected to the T vector, digested with restriction enzymes, and transferred into the expression vector pC1300T.
Embodiment 3
[0045] Three, embodiment 3: plant expression vector transforms Agrobacterium
[0046] 1. Agrobacterium activation
[0047] Draw the preserved Agrobacterium (EHA105) on the solid LB medium (add antibiotics: Kan, if no antibiotics are added, the Ti plasmid of these strains may be lost, resulting in the lack of infectivity of Agrobacterium), the antibiotic concentration is: 50μg / mL, culture at 28°C for 1-2 days, then transfer to a new solid LB medium with antibiotics and culture for another 2 days;
[0048] 2. Preparation of Agrobacterium Competent Cells
[0049] Inoculate 100 μL into 1 mL of LB liquid medium, shake at 150 rpm at 28°C overnight;
[0050] Take 1mL of the bacterial liquid and inoculate it into 100mL of liquid medium and cultivate until OD600=0.5;
[0051] Place the bacterial solution on ice for 30 minutes, and cool the culture to 0°C;
[0052] Centrifuge at 5000rpm for 30s at 4°C and discard the supernatant;
[0053] Precipitate with 60mL 0.1M CaCl 2 Suspende...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



