Method, kit, oligonucleotide and application thereof for detecting pklr gene mutation
An oligonucleotide and PKLR-2R technology, which is used in the detection of PKLR gene mutations, kits, oligonucleotides and its applications, can solve the problem of reducing pyruvate kinase activity, decreasing hydrophobicity, and affecting trimer formation, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0081] An oligonucleotide for detecting polymorphic mutation sites of the PKLR gene, the oligonucleotide is designed for at least one exon of the PKLR gene, including at least one pair of amplification primers, and the at least one pair of amplification primers selected from PKLR-1F / PKLR-1R, PKLR-2F / PKLR-2R, PKLR-3-4-5F / PKLR-3-4-5R, PKLR-6-7F / PKLR-6-7R, PKLR-8- 9F / PKLR-8-9R, PKLR-10F / PKLR-10R, or PKLR-11F / PKLR-11R, its base sequence is:
[0082] PKLR-1F: TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA;
[0083] PKLR-1R: AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT;
[0084] PKLR-2F: TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA;
[0085] PKLR-2R: AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA;
[0086] PKLR-3-4-5F: TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA;
[0087] PKLR-3-4-5R: AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG;
[0088] PKLR-6-7F: TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT;
[0089] PKLR-6-7R: AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAAA;
[0090] PKLR-8-9F: TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC;
...
Embodiment 2
[0104] Example 2 Blood Sample DNA Extraction
[0105] Blood sample DNA extraction (according to the instructions of Tiangen Bio-Blood / Cell / Tissue Gene DNA Extraction Kit): extract human blood sample DNA, the specific extraction method is as follows:
[0106] (1) Take 300 μl of blood and add 900 μl of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed;
[0107] (2) Add 20 μl proteinase K solution and mix well;
[0108] (3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;
[0109] (4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and bri...
Embodiment 3
[0116] Example 3 sample DNA amplification
[0117] The blood sample DNA extracted according to Example 2 was then amplified with the amplification primers in Example 1 to amplify the exons of the human PKLR gene to obtain the amplified product. Amplification was carried out on a conventional PCR instrument, available instruments include ABI veriti (Applied Biosystems, USA) and the like. The details are as follows:
[0118] (i) According to the number of samples n (number of samples = number of samples to be tested + 1 negative control + 1 positive control + 1 blank control), the PCR amplification reaction solution of the detection system is taken, and 19 μL of each tube is divided into reaction tubes;
[0119] (ii) Add 1 μL each of the above-mentioned processed sample to be tested, the negative control substance, and the positive control substance into the reaction tube, mix well, centrifuge at low speed for several seconds, perform PCR amplification, and obtain the amplified...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com