Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method, kit, oligonucleotide and application thereof for detecting pklr gene mutation

An oligonucleotide and PKLR-2R technology, which is used in the detection of PKLR gene mutations, kits, oligonucleotides and its applications, can solve the problem of reducing pyruvate kinase activity, decreasing hydrophobicity, and affecting trimer formation, etc. question

Active Publication Date: 2020-11-06
CHANGSHA ADICON CLINICAL LAB
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] So far, the mechanism of how the mutation of the PKLR gene causes enzyme deficiency is not completely clear. The possible reasons are: some mutations are located in the active center of pyruvate kinase, which changes the binding ability of the substrate phosphoenolpyruvate; some mutations may cause Hydrophobicity decreases near the mutation point, affecting K + Combining with it leads to an increase in Km; a small number of mutations in the C region will change the structure, weaken the connection between subunits, affect the formation of trimers, and reduce the activity of pyruvate kinase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, kit, oligonucleotide and application thereof for detecting pklr gene mutation
  • Method, kit, oligonucleotide and application thereof for detecting pklr gene mutation
  • Method, kit, oligonucleotide and application thereof for detecting pklr gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] An oligonucleotide for detecting polymorphic mutation sites of the PKLR gene, the oligonucleotide is designed for at least one exon of the PKLR gene, including at least one pair of amplification primers, and the at least one pair of amplification primers selected from PKLR-1F / PKLR-1R, PKLR-2F / PKLR-2R, PKLR-3-4-5F / PKLR-3-4-5R, PKLR-6-7F / PKLR-6-7R, PKLR-8- 9F / PKLR-8-9R, PKLR-10F / PKLR-10R, or PKLR-11F / PKLR-11R, its base sequence is:

[0082] PKLR-1F: TGTAAAACGACGGCCAGTAGAGGAAATGCCAGGAGATGA;

[0083] PKLR-1R: AACAGCTATGACCATGTTCACCCTCATTTTCCTCCTAT;

[0084] PKLR-2F: TGTAAAACGACGGCCAGTAGAGGGTATGCTGAGAGACGAA;

[0085] PKLR-2R: AACAGCTATGACCATGAAGAAGCACCTCAAGAAATACCA;

[0086] PKLR-3-4-5F: TGTAAAACGACGGCCAGTGGGTTGCATCAGGGAATAAA;

[0087] PKLR-3-4-5R: AACAGCTATGACCATGGCCAAGGAGAAGGGAATGTG;

[0088] PKLR-6-7F: TGTAAAACGACGGCCAGTGACTATGGGTGGGTCGTTTCT;

[0089] PKLR-6-7R: AACAGCTATGACCATGCACCCACAGGTGTCCCTAAAAA;

[0090] PKLR-8-9F: TGTAAAACGACGGCCAGTGTGTGGGTGTCAGAGAAGTAGC;

...

Embodiment 2

[0104] Example 2 Blood Sample DNA Extraction

[0105] Blood sample DNA extraction (according to the instructions of Tiangen Bio-Blood / Cell / Tissue Gene DNA Extraction Kit): extract human blood sample DNA, the specific extraction method is as follows:

[0106] (1) Take 300 μl of blood and add 900 μl of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 12000rpm for 1min, suck off the supernatant, leave the white blood cell pellet, add 200μl buffer GA, shake until thoroughly mixed;

[0107] (2) Add 20 μl proteinase K solution and mix well;

[0108] (3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0109] (4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and bri...

Embodiment 3

[0116] Example 3 sample DNA amplification

[0117] The blood sample DNA extracted according to Example 2 was then amplified with the amplification primers in Example 1 to amplify the exons of the human PKLR gene to obtain the amplified product. Amplification was carried out on a conventional PCR instrument, available instruments include ABI veriti (Applied Biosystems, USA) and the like. The details are as follows:

[0118] (i) According to the number of samples n (number of samples = number of samples to be tested + 1 negative control + 1 positive control + 1 blank control), the PCR amplification reaction solution of the detection system is taken, and 19 μL of each tube is divided into reaction tubes;

[0119] (ii) Add 1 μL each of the above-mentioned processed sample to be tested, the negative control substance, and the positive control substance into the reaction tube, mix well, centrifuge at low speed for several seconds, perform PCR amplification, and obtain the amplified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses primers and method for detecting PKLR gene mutation of autosomal recessive inherited disease pyruvate kinase deficiency patients. The primers comprise primers for amplifying all exon sequences of the PKLR gene, and the Sanger sequencing technique and sequencing primers are adopted. Mutation of all exons of the PKLR gene in pyruvate kinase deficiency patients can be detected quickly. A detection result is accurate, assistant diagnosis of pyruvate kinase deficiency can be achieved, and reference is provided for early intervention, early treatment and prenatal diagnosis.

Description

Background technique [0001] Erythrocyte pyruvate kinase is one of the three key rate-limiting enzymes of the glycolytic pathway. Its role is to catalyze the conversion of phosphoenone pyruvate into pyruvate, and at the same time generate ATP to provide energy for red blood cells. Pyruvate kinase (PK) has four isoenzymes: L, R, M1, M2, of which the R type exists in mature red blood cells and is encoded by the PKLR gene. Inherited deficiency of pyruvate kinase in erythrocytes can cause abnormal energy metabolism of erythrocytes, non-spherical hemolytic anemia, and there are mutations of PKLR gene at the molecular level. [0002] The PKLR gene is located in zone 1, region 2, long arm of chromosome 1, and contains 11 exons, encoding a total of 574 amino acids. Mutations in the PKLR gene are an important cause of pyruvate kinase deficiency. Since the initial report in 1961, more than 200 cases of PKLR mutations have been found at home and abroad so far. The mutation types of PK...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6869C12Q2531/113C12Q2535/122C12Q2525/191
Inventor 林筱剑黄开新王淑一
Owner CHANGSHA ADICON CLINICAL LAB
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com