An internal reference amplification primer composition for detecting calr gene mutation and its amplification system

A technology of amplification system and amplification primers, which is applied in the field of molecular biology, can solve the problems of high technical platform requirements, difficulty in widespread promotion, and time-consuming and labor-intensive problems

Active Publication Date: 2021-03-02
AFFILIATED HUSN HOSPITAL OF FUDAN UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The detection of CALR gene mutations mainly relies on probe real-time PCR or sequencing methods, etc. The above methods are time-consuming and labor-intensive, have a long reporting cycle, and have defects in sensitivity. The detection equipment required is expensive, and special equipment must be used for detection. And well-trained technical personnel, high requirements on the technical platform, it is not easy to widely promote

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An internal reference amplification primer composition for detecting calr gene mutation and its amplification system
  • An internal reference amplification primer composition for detecting calr gene mutation and its amplification system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] This example is the target sequence of the CALR gene mutation used in the present invention, and the internal reference amplification primers used to detect the CALR gene mutation.

[0030] In the relatively conserved sequence region of the CALR gene, the target fragment was selected to design primers, and after optimization and screening, appropriate specific primers were designed.

[0031] The length of the target fragment is 214bp, and the specific sequence is:

[0032] TTGCAGACAAGCCAGGATGCACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAGACGCTGGTGGTGCAGTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGGCGGCTATGTGAAGCTGTTTCCTAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCCCGACATCT (SEQ ID NO: 7);

[0033] The primer sequences are:

[0034] F3: 5'-TTGCAGACAAGCCAGGATG-3' (SEQ ID NO: 1);

[0035] B3: 5'-AGATGTCGGGACCAAACATG-3' (SEQ ID NO: 2);

[0036] FIP: 5'-TGAACTGCACCACCAGCGTCCTCTGTCGGCCAGTTTCG-3' (SEQ ID NO: 3)

[0037] BIP: 5'-GCAGAACATCGACTGTGGGGGTCTGAGTCTCCG...

Embodiment 2

[0041] This embodiment is an internal reference amplification system, kit and amplification detection method for detecting CALR gene mutations of the present invention.

[0042]The test kit for detecting CALR gene mutation according to the present invention includes an internal reference amplification system whose total volume is 25 μL, which includes 12.5 μL of 2× reaction buffer (RM), primer F3: 1 μL (final concentration 0.2 μmol / L), primer B3: 1 μL (final concentration 0.2 μmol / L), primer FIP: 0.5 μL (final concentration 1.6 μmol / L), primer BIP: 1 μL (final concentration 1.6 μmol / L), primer LF: 1 μL ( Final concentration 0.8 μmol / L), primer LB: 1 μL (final concentration 0.8 μmol / L), Bst DNA polymerase 1 μL (8U), calcein (FD) 1 μL, deionized water 3.0 μL, DNA template 2 μL.

[0043] Use the above kit for LAMP reaction, the LAMP reaction conditions are: 65°C, 60min; the equipment used is a common PCR instrument or a constant temperature metal bath that can stably provide a co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to an internal reference amplification primer composition for detecting CALR gene mutations, which includes primers of the sequence shown in SEQ ID NO: 1-SEQ ID NO: 6; the present invention also relates to a composition containing the above internal reference amplification primers The internal reference amplification system and its kit and detection method, and the target sequence of the CALR gene mutation amplified by the above internal reference amplification primer composition, the target sequence is the sequence shown in SEQ ID NO:7. The internal reference amplification system of the present invention and its detection method are used in conjunction with the mutation system of the CALR gene, which can quickly detect the mutant CALR gene, and can also amplify the wild-type CALR gene as a CALR mutation The internal reference quality control system of the detection kit is of great significance in improving quality control.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to an internal reference amplification primer composition for detecting CALR gene mutations, an amplification system, and an amplification detection method. Background technique [0002] Myeloproliferative neoplasms (MPNs) are clonal hematopoietic stem / progenitor cell disorders characterized by proliferation of one or more myeloid cells in the bone marrow and increased mature and immature cells in the peripheral blood. In recent years, multiple molecular markers, such as JAK2, MPL, and TET mutations, have been discovered one after another. The discovery of these markers is of great significance for understanding the molecular pathogenesis of MPN, and is also helpful for the diagnosis and treatment of patients with this disease . However, 30% to 45% of patients with essential thrombocythemia (ET) or primary myelofibrosis (PMF) carrying wild-type JAK2 / MPL are still difficult to diagn...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6858C12Q1/6886C12N15/11
CPCC12Q1/6858C12Q1/6886C12Q2600/156C12Q2600/166C12Q2531/119C12Q2545/101
Inventor 曹国君关明周连群张威马玮哲康志华张心菊黄秀邓萱许笑邢志芳
Owner AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap