An internal reference amplification primer composition for detecting calr gene mutation and its amplification system
A technology of amplification system and amplification primers, which is applied in the field of molecular biology, can solve the problems of high technical platform requirements, difficulty in widespread promotion, and time-consuming and labor-intensive problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] This example is the target sequence of the CALR gene mutation used in the present invention, and the internal reference amplification primers used to detect the CALR gene mutation.
[0030] In the relatively conserved sequence region of the CALR gene, the target fragment was selected to design primers, and after optimization and screening, appropriate specific primers were designed.
[0031] The length of the target fragment is 214bp, and the specific sequence is:
[0032] TTGCAGACAAGCCAGGATGCACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAGACGCTGGTGGTGCAGTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGGCGGCTATGTGAAGCTGTTTCCTAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCCCGACATCT (SEQ ID NO: 7);
[0033] The primer sequences are:
[0034] F3: 5'-TTGCAGACAAGCCAGGATG-3' (SEQ ID NO: 1);
[0035] B3: 5'-AGATGTCGGGACCAAACATG-3' (SEQ ID NO: 2);
[0036] FIP: 5'-TGAACTGCACCACCAGCGTCCTCTGTCGGCCAGTTTCG-3' (SEQ ID NO: 3)
[0037] BIP: 5'-GCAGAACATCGACTGTGGGGGTCTGAGTCTCCG...
Embodiment 2
[0041] This embodiment is an internal reference amplification system, kit and amplification detection method for detecting CALR gene mutations of the present invention.
[0042]The test kit for detecting CALR gene mutation according to the present invention includes an internal reference amplification system whose total volume is 25 μL, which includes 12.5 μL of 2× reaction buffer (RM), primer F3: 1 μL (final concentration 0.2 μmol / L), primer B3: 1 μL (final concentration 0.2 μmol / L), primer FIP: 0.5 μL (final concentration 1.6 μmol / L), primer BIP: 1 μL (final concentration 1.6 μmol / L), primer LF: 1 μL ( Final concentration 0.8 μmol / L), primer LB: 1 μL (final concentration 0.8 μmol / L), Bst DNA polymerase 1 μL (8U), calcein (FD) 1 μL, deionized water 3.0 μL, DNA template 2 μL.
[0043] Use the above kit for LAMP reaction, the LAMP reaction conditions are: 65°C, 60min; the equipment used is a common PCR instrument or a constant temperature metal bath that can stably provide a co...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


