A kind of soluble heterogeneous dimerization T cell receptor and its preparation method and application
A cell receptor and cell technology, applied in the field of biomedicine, can solve the problems that cannot be used to identify suitable sites for new interchain disulfide bonds, and the difficulty of specific binding to active TCR
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0219] Example 1 Primer design and PCR mutation of LC13 molecule with artificial interchain disulfide bond introduced at position 53 of TRAC*01 exon 1 and position 54 of TRBC1*01 or TRBC2*01 exon 1
[0220] The 53rd arginine of exon 1 of TRAC*01 exon 1 of TCR molecule LC13 (for antigenic short peptide HLA-B4405: EEYLKAWTF (SEQ ID NO.:49)) was mutated to cysteine, and its TRBC1* 01 or TRBC2*01 exon 1 serine 54 was mutated to cysteine to form an artificial interchain disulfide bond.
[0221] When the arginine at position 53 of TRAC*01 exon 1 of the above TCR is mutated to cysteine, the designed primers are as follows:
[0222] 5'-3'
[0223] GATAAATGCGTGCTGGATATGTGCAGCATGGATTTCAAAAG (SEQ ID NO.: 50)
[0224] CTTTTGAAATCCATGCTGCACATATCCAGCACGCATTTATC (SEQ ID NO.:51)
[0225] When the 54th serine of TRBC1*01 or TRBC2*01 exon 1 of the above TCR is mutated to cysteine, the designed primers are as follows:
[0226] 5'-3'
[0227] GGCAAAGAAGTGCATTGCGGTGTTTGTACCGATC (SEQ ID NO.:...
Embodiment 2
[0232] Example 2 Expression, refolding and purification of TCR and its result determination
[0233] Expression of TCR protein
[0234] The target gene carrying the template strand was digested with NcoI and NotI, and then ligated with the pET28a (Novagen) vector that had been digested with NcoI and NotI. The ligation product was transformed into E.coli DH5α (Tiangen), spread on LB plates containing kanamycin, cultured upside down at 37°C overnight, picked clones for PCR screening, and sequenced positive recombinants.
[0235] The expression plasmids containing TCRα and β chains were respectively transformed into Escherichia coli strain BL21 (DE3), and LB plates (kanamycin 50 μg / ml) were spread and cultured overnight at 37°C. The next day, pick clones and inoculate them into 10ml LB liquid medium (Kanamycin 50μg / ml) for 2-3h, then inoculate them into 1L LB medium (Kanamycin 50μg / ml) at a volume ratio of 1:100, continue Grow to OD 600 0.5-0.8, and then use IPTG with a final ...
Embodiment 3
[0247] Example 3 Stability Test of TCR Containing Artificial Interchain Disulfide Bonds
[0248] 1 ml of the LC13 TCR protein (concentration: 0.5 mg / ml) obtained in Example 2 was dialyzed into PBS, and the thermal stability of the TCR protein was determined using a differential scanning calorimeter (Nano DSC) from TA (waters) Company, USA. The detected temperature range is 10-90°C, and the heating rate is 1°C / min. The dialyzed fluid PBS was used as a control, and the baseline was measured 3 times. After the baseline was stable, the protein sample was detected again. After collecting the data, use the analysis software TA_DSC_NanoAnalyze to measure the Tm value of TCR and obtain its DSC thermogram. The DSC thermogram of the LC13 TCR of the present invention containing artificial interchain disulfide bonds obtained through in vitro soluble expression is as follows Figure 5 As shown, its Tm value can reach 55.82°C. The thermogram can reflect that at room temperature, even whe...
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
| melting point | aaaaa | aaaaa |
| melting point | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


