Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of soluble heterogeneous dimerization T cell receptor and its preparation method and application

A cell receptor and cell technology, applied in the field of biomedicine, can solve the problems that cannot be used to identify suitable sites for new interchain disulfide bonds, and the difficulty of specific binding to active TCR

Active Publication Date: 2021-01-29
XLIFESC LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The stability of TCR can be improved by mutating non-cysteine ​​residues in the constant domains of each chain of TCR to cysteine ​​to form artificial interchain disulfide bonds, but between the antibody constant domain and the TCR constant domain In the absence of such homology, this technique cannot be used to identify suitable sites for new interchain disulfide bonds between TCR constant domains
[0008] Theoretically, there are many sites that can form artificial interchain disulfide bonds in TCR, but finding a suitable site for forming artificial interchain disulfide bonds in TCR allows TCRs containing artificial interchain disulfide bonds to be successfully replicated. It is very difficult to obtain TCR with high yield, high stability and specific binding activity to its original ligand through refolding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of soluble heterogeneous dimerization T cell receptor and its preparation method and application
  • A kind of soluble heterogeneous dimerization T cell receptor and its preparation method and application
  • A kind of soluble heterogeneous dimerization T cell receptor and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0219] Example 1 Primer design and PCR mutation of LC13 molecule with artificial interchain disulfide bond introduced at position 53 of TRAC*01 exon 1 and position 54 of TRBC1*01 or TRBC2*01 exon 1

[0220] The 53rd arginine of exon 1 of TRAC*01 exon 1 of TCR molecule LC13 (for antigenic short peptide HLA-B4405: EEYLKAWTF (SEQ ID NO.:49)) was mutated to cysteine, and its TRBC1* 01 or TRBC2*01 exon 1 serine 54 was mutated to cysteine ​​to form an artificial interchain disulfide bond.

[0221] When the arginine at position 53 of TRAC*01 exon 1 of the above TCR is mutated to cysteine, the designed primers are as follows:

[0222] 5'-3'

[0223] GATAAATGCGTGCTGGATATGTGCAGCATGGATTTCAAAAG (SEQ ID NO.: 50)

[0224] CTTTTGAAATCCATGCTGCACATATCCAGCACGCATTTATC (SEQ ID NO.:51)

[0225] When the 54th serine of TRBC1*01 or TRBC2*01 exon 1 of the above TCR is mutated to cysteine, the designed primers are as follows:

[0226] 5'-3'

[0227] GGCAAAGAAGTGCATTGCGGTGTTTGTACCGATC (SEQ ID NO.:...

Embodiment 2

[0232] Example 2 Expression, refolding and purification of TCR and its result determination

[0233] Expression of TCR protein

[0234] The target gene carrying the template strand was digested with NcoI and NotI, and then ligated with the pET28a (Novagen) vector that had been digested with NcoI and NotI. The ligation product was transformed into E.coli DH5α (Tiangen), spread on LB plates containing kanamycin, cultured upside down at 37°C overnight, picked clones for PCR screening, and sequenced positive recombinants.

[0235] The expression plasmids containing TCRα and β chains were respectively transformed into Escherichia coli strain BL21 (DE3), and LB plates (kanamycin 50 μg / ml) were spread and cultured overnight at 37°C. The next day, pick clones and inoculate them into 10ml LB liquid medium (Kanamycin 50μg / ml) for 2-3h, then inoculate them into 1L LB medium (Kanamycin 50μg / ml) at a volume ratio of 1:100, continue Grow to OD 600 0.5-0.8, and then use IPTG with a final ...

Embodiment 3

[0247] Example 3 Stability Test of TCR Containing Artificial Interchain Disulfide Bonds

[0248] 1 ml of the LC13 TCR protein (concentration: 0.5 mg / ml) obtained in Example 2 was dialyzed into PBS, and the thermal stability of the TCR protein was determined using a differential scanning calorimeter (Nano DSC) from TA (waters) Company, USA. The detected temperature range is 10-90°C, and the heating rate is 1°C / min. The dialyzed fluid PBS was used as a control, and the baseline was measured 3 times. After the baseline was stable, the protein sample was detected again. After collecting the data, use the analysis software TA_DSC_NanoAnalyze to measure the Tm value of TCR and obtain its DSC thermogram. The DSC thermogram of the LC13 TCR of the present invention containing artificial interchain disulfide bonds obtained through in vitro soluble expression is as follows Figure 5 As shown, its Tm value can reach 55.82°C. The thermogram can reflect that at room temperature, even whe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
melting pointaaaaaaaaaa
melting pointaaaaaaaaaa
Login to View More

Abstract

The present invention provides a highly stable T cell receptor (TCR), which comprises (i) all or part of the TCRα chain except its transmembrane domain, and (ii) except its transmembrane domain All or part of the TCR beta chain, wherein (i) and (ii) both comprise a functional variable domain and at least a part of the constant domain of the TCR chain. An artificial interchain disulfide bond connects the constant regions of the TCRα and β chains, and the Tm value of the T cell receptor is greater than or equal to 45°C.

Description

technical field [0001] The invention belongs to the field of biomedicine, in particular, the invention relates to a highly stable soluble T cell receptor and its preparation method and application. Background technique [0002] There are only two types of molecules that recognize antigens in a specific manner. One of them is immunoglobulin or antibody; the other is T cell receptor (TCR), which is a glycoprotein on the cell membrane surface that exists in the form of a heterodimer of α chain / β chain or γ chain / δ chain. The composition of the immune system's TCR repertoire is generated in the thymus by V(D)J recombination followed by positive and negative selection. In the peripheral environment, TCR mediates the specific recognition of major histocompatibility complex-peptide complex (pMHC) by T cells and is therefore critical to the cellular immune function of the immune system. [0003] TCR is the sole receptor for specific antigenic peptides presented on the major histoc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/725C12N15/12C12N15/63C12N1/21A61K38/17A61P35/00A61P31/12A61P37/02
CPCA61K38/00C12N15/70C07K14/7051A61K38/17C12N15/63A61K47/62C07K16/2809C07K2319/30
Inventor 李懿樊辉
Owner XLIFESC LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More