Mini-gene splicing reporter plasmid and its construction method and application
A reporter plasmid and plasmid technology, applied in the field of molecular biology, can solve problems such as difficulty in grasping the relationship between mutation, splicing and splicing and diseases
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Construction process of minigene splicing reporter plasmid
[0038] The non-contiguous sequences on the three DMD genes were obtained by PCR amplification, and were respectively inserted into pcDNA3.1 to construct the minigene reporter plasmid NKU-YC-1.
[0039] Materials and Reagents:
[0040] The vector pcDNA3.1 was purchased from Invitrogen, the LB culture plate and culture medium were purchased from Shanghai Sangon Biological Company, the competent Trans1-T1 was purchased from Quanshijin Bio Company, and the agarose recovery kit and T4 ligase were purchased from NEB Bio Company , the restriction endonucleases used in the experiment were purchased from TAKARA Biological Company.
[0041] (1) Using the genomic DNA of a normal person as a template, design primers Y1F-NheI (sequence shown in SEQ ID NO: 3 in the sequence table) and Y1R-KpnI (sequence shown in SEQ ID NO: 4 in the sequence table) for PCR amplification . The primers are as follows (where the underline is...
Embodiment 2
[0060] Construction method of mutant mini-gene
[0061] Design primers M-F: GTGGGCAGTAGATAAAGAATGAAGC
[0062] M-R:CTTTATCTACTGCCCACCTTCATTG
[0063] Using the NKU-YC-1 plasmid as a template, design primers M-F (sequence shown in the sequence table SEQ ID NO:9) and M-R (sequence shown in the sequence table SEQ ID NO:10) for PCR amplification, the primers are as follows:
[0064] M-F: GTGGGCAGTAGATAAAGAATGAAGC
[0065] M-R:CTTTATCTACTGCCCACCTTCATTG
[0066]
[0067] After mixing the components, put them into the PCR machine. PCR reaction parameters: pre-denaturation at 94°C for 5min, denaturation at 94°C for 30s, annealing at 60°C for 30s, extension at 72°C for 10min, 35 cycles, and stop extension at 72°C for 5min. After the reaction was completed, 5 ul of the PCR product was taken for electrophoresis to detect the amplified product fragment, and the fragment size was about 5 kb. Take 20ul of the PCR product for DpnI enzyme digestion and digestion. The enzyme digestion ...
Embodiment 3
[0071] Functional validation of a mini-gene splicing reporter system
[0072] 1) The plasmid NKU-YC-1 was transfected into Hela cells by a liposome-mediated method. The transfection reagent used liposome Lipo2000 from Invitrogen Company. The transfection method refers to the instructions of the transfection reagent. The specific operations are as follows:
[0073] The night before, add 0.5ug plasmid and 8ul transfection reagent to 200ul serum-free medium, incubate at room temperature for 5min, so that the liposomes can fully wrap the plasmid, then add it to 2ml well-grown Hela cells, place in The incubator was cultured overnight, and the serum-free medium was replaced with serum-containing medium the next morning to continue culturing.
[0074] 2) RNA extraction: 48 hours after transfection, aspirate the culture medium, wash twice with PBS, add 500ul Trizol to wash repeatedly, and transfer to a 1.5ml centrifuge tube. Add 100ul of chloroform, shake vigorously for 15s, let stan...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com