LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof

A primer combination and primer set technology, which is applied in the direction of microorganism-based methods, microorganisms, and microorganism determination/inspection, can solve the problems of long PCR detection time, heavy workload, and low sensitivity

Active Publication Date: 2018-01-05
CAPITALBIO CORP
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional methods for detecting pathogenic bacteria such as isolation culture, morphological observation, physiology and biochemistry, and selective medium have the characteristics of low sensitivity, poor specificity, heavy workload, long time-consuming, and low throughput.
The microbial culture method takes a long time and needs 3-4 days to produce a test report, which cannot meet the purpose of timely treating bovine mastitis against pathogens
Immunological techniques (such as ELISA) have high sensitivity, but are prone to contamination and often have false positives
Usually, a specific primer for one pathogenic bacteria and one specific primer is used to check the specific pathogen. Although it can achieve the purpose of rapid, correct and convenient diagnosis of a single bacterium, when the pathogen is not named, it needs a variety of different primers for detection. test, which is clearly not ideal for the complexity of pathogens and the diversity of PCR programs
PCR has the disadvantages of long detection time, easy contamination, and high false positive rate, which limits its application.
There are many technical problems in the above technologies and methods for the detection of pathogenic microorganisms, and in practice, due to the wide variety of pathogenic microorganisms, it is difficult for the above methods to efficiently detect multiple pathogenic microorganisms at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof
  • LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof
  • LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0235] Embodiment 1, the preparation of kit

[0236] The kit consists of eight LAMP primer sets, each for the detection of one environmental pathogen of dairy mastitis.

[0237] The primer set used to detect E. coli is as follows (5'→3'):

[0238] Outer primer F3 (SEQ ID NO: 1): TGTGGAATTGATCAGCGTT;

[0239] Outer primer B3 (SEQ ID NO: 2): TGATTATTGACCCACACTTTG;

[0240] Internal primer FIP (SEQ ID NO: 3): TCTGCATCGGCGAACTGATCGGGTGGGAAAGCGCGTTAC;

[0241] Internal primer BIP (SEQ ID NO: 4): TCTGGTATCAGCGCGAAGTCTAATGAGTGACCGCATCGA;

[0242] Loop primer LF (SEQ ID NO: 5): GCAATTGCCCGGCTTTCTT;

[0243] Loop primer LB (SEQ ID NO: 6): GCAGGCCAGCGTATCGT.

[0244] The primer set used to detect Klebsiella pneumoniae is as follows (5'→3'):

[0245] Outer primer F3 (SEQ ID NO: 7): ATACAAAAACACCAGTGTAGG;

[0246] Outer primer B3 (SEQ ID NO: 8): GCCGCCAGTTTGTTTCAG;

[0247] Internal primer FIP (SEQ ID NO: 9): CGTTGAGATTTGCGAAGTACCAAGAATCAAATATGCTGCAAATGTG;

[0248] Internal prime...

Embodiment 2

[0294] Embodiment 2, specificity

[0295] Test sample 1: Escherichia coli ( 8739 TM ).

[0296] Test sample 2: Klebsiella pneumoniae ( 13883 TM ).

[0297] Test sample 3: Pseudomonas aeruginosa (CVCC 3359).

[0298] Test sample 4: Streptococcus dysgalactiae ( 12388 TM ).

[0299] Test sample 5: Streptococcus uberis ( 700407 TM ).

[0300] Test sample 6: Salmonella typhimurium ( 14028 TM ).

[0301] Test sample 7: Proteus mirabilis (CVCC 1969).

[0302] Test sample 8: Candida albicans (CGMCC 2.2086).

[0303] Each sample to be tested carries out the following steps respectively:

[0304] 1. Extract the genomic DNA of the sample to be tested.

[0305] 2. Using the genomic DNA extracted in step 1 as a template, each primer set prepared in Example 1 was used to perform loop-mediated isothermal amplification.

[0306] Reaction system (10 μL): 7.0 μL reaction solution (product of Boao Bio Group Co., Ltd., catalog number CP.440020), 1 μL primer mixture, 1 μL te...

Embodiment 3

[0318] Embodiment 3, sensitivity result

[0319] Test sample 1: Escherichia coli ( 8739 TM ).

[0320] Test sample 2: Klebsiella pneumoniae ( 13883 TM ).

[0321] Test sample 3: Pseudomonas aeruginosa (CVCC 3359).

[0322] Test sample 4: Streptococcus dysgalactiae ( 12388 TM ).

[0323] Test sample 5: Streptococcus uberis ( 700407 TM ).

[0324] Test sample 6: Salmonella typhimurium ( 14028 TM ).

[0325] Test sample 7: Proteus mirabilis (CVCC 1969).

[0326] Test sample 8: Candida albicans (CGMCC 2.2086).

[0327] 1. Extract the genomic DNA of the sample to be tested, and perform gradient dilution with sterile water to obtain each dilution.

[0328] 2. Using the dilution obtained in step 1 as a template, the primer sets prepared in Example 1 were used to perform loop-mediated isothermal amplification.

[0329] When the sample to be tested is the sample to be tested 1, the loop-mediated isothermal amplification is performed using primer set I. When the s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP primer combination for detecting 8 environmental pathogens of dairy cow mastitis and application thereof. The primer combination provided by the invention is composed of 48 primers shown in sequence 1 to sequence 48. The primer combination provided by the invention can be used for detecting whether a to-be-detected bacterium is Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus dysgalactiae, Streptococcus uberis, Salmonella typhimurium, Proteus mirabilis or Candida albicans, and can be used for detecting whether a to-be-detected sample contains Escherichia coli and / or Klebsiella pneumonia and / or Pseudomonas aeruginosa and / or Streptococcus dysgalactiae and / or Streptococcus uberis and / or Salmonella typhimurium and / or Proteus mirabilis and / or Candida albicans. The primer combination provided by the invention is used for identifying and detecting the 8 environmental pathogens of dairy cow mastitis, has high specificity and high sensitivity, and can realize simple, rapid and accurate detection, thus having great popularization value.

Description

technical field [0001] The invention relates to a combination of LAMP primers for detecting eight environmental pathogens of cow mastitis and its application. Background technique [0002] Mastitis in dairy cows is inflammation of the lactating tissue in the milk area, usually caused by bacterial infection, and occurs in one or more milk areas, resulting in reduced milk production, cessation of milk production, and changes in milk quality. Dairy mastitis affects 25-50% of dairy cows every year and is the most costly disease in dairy farming. [0003] Cow mastitis is caused by a variety of non-specific pathogenic microorganisms. At present, there are about 150 kinds (including cocci, bacilli, mycoplasma, fungi or yeasts, viruses, etc.), among which the more common ones can be divided into infectious pathogens and non-communicable pathogens. According to reports, the annual loss caused by cow mastitis in the world is 2 billion US dollars in the United States, 267 million in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6895C12Q1/689C12Q1/6844C12R1/19C12R1/22C12R1/385C12R1/46C12R1/42C12R1/725C12R1/37
Inventor张岩王玉邢婉丽程京
OwnerCAPITALBIO CORP