Magnetic nanomaterial-mediated CRISPR/Cas9 T-cell internal delivery system and preparation method and application thereof
A magnetic nanometer and delivery system technology, applied in the biological field, can solve the problems of high cost, easy cytotoxicity, and large side effects, and achieve efficient editing, good application prospects, safe and efficient editing effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1 Construction of CRISPR-Cas9 specific knockout human PD-1 gene plasmid vector
[0043] Obtain sgRNA double-stranded (DNA double-stranded complementary to the target sgRNA) fragments. The sgRNA sequence targeting the human PD-1 gene is selected from the literature (Shu Su. et al. CRISPR-Cas9mediated efficient PD-1 disruption on human primary T cells from cancer patients. Scientific Reports 2016; 6:20070), forward strand: 5' - GCAGTTGTGTGACACGGAAG, reverse strand: 5'-CTTCCGTGTCACACAACTGC. According to the selected sgRNA target sequence, synthesize a pair of complementary DNA oligonucleotide chains (synthesized by Takara):
[0044] Forward strand S1: 5'-CACCGCAGTTGTGTGACACGGAAG (SEQ ID No: 1);
[0045] Reverse strand S2: 5'-AAACCTTCCGTGTCACACAACTGC (SEQ ID No: 2).
[0046] Anneal a pair of DNA oligonucleotide strands into double-stranded DNA. The annealing system (20 μL) is as follows: forward strand (100 μM) 1 μL; reverse strand (100 μM) 1 μL; sterilized water...
Embodiment 2
[0050] Example 2 Fe 3 o 4 Preparation of Nanoparticle-mediated CRISPR / Cas9 Intracellular Delivery System
[0051] Fe 3 o 4 Nanoparticles (single particle diameter 10nm, cluster particle diameter 5-200nm, Chemicell). Polyethyleneimine modifies this nanoparticle (see literature specifically: Cai Yuanyuan etc., PEI modifies magnetic Fe 3 o 4 Preparation and Characterization of Nanoparticles, Science and Technology Herald, 2010, 28, 68). Fe 3 o 4 Nanoparticle clusters were dispersed in an aqueous solution, and PEI solution (Sigma-aldrich, average Mw 800, product number 408719) diluted in Millipore water was added dropwise at a mass ratio of 1:8, stirred at 1400r / min for 30min to obtain PEI-modified Fe 3 o 4 Nanoparticles (Fe 3 o 4 -PEI). Under the action of a magnetic field, observe its magnetic field response ability.
[0052] Will Fe 3 o 4 -PEI and the plasmid targeting the knockout of human PD-1 gene were mixed in millipore pure water at a mass ratio of 10:1, inc...
Embodiment 3
[0054] Example 3 Fe 3 o 4 Comparison of Magnetic Field Response Forces of Nanoparticles in Cluster and Monodisperse Situations
[0055] Fe 3 o 4 Nanoparticles (monodisperse, Hangzhou Nanocrystal). PBS buffer and Fe 3 o 4 The nanoparticle solution (1mg / mL) was mixed in equal volumes and shaken at 350rpm for 2h to obtain Fe 3 o 4 Nanoparticle clusters, under the action of a magnetic field, observe their magnetic field responsiveness.
[0056] Result: Fe 3 o 4 The average particle size of nanometer monodisperse particles is 13nm, after adding PBS buffer solution, the formed Fe 3 o 4 The average particle size of the nanoclusters is 179nm. Fe 3 o 4 Nanoparticle single particle and cluster TEM images are shown in Figure 3A (left), Figure 3B (left), both have good water solubility. Under the action of a magnetic field, single particles have no obvious magnetic field response ability, while clusters have good magnetic field response ability, see respectively Figure ...
PUM
Property | Measurement | Unit |
---|---|---|
Particle size | aaaaa | aaaaa |
Particle size | aaaaa | aaaaa |
The average particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap