Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Magnetic nanomaterial-mediated CRISPR/Cas9 T-cell internal delivery system and preparation method and application thereof

A magnetic nanometer and delivery system technology, applied in the biological field, can solve the problems of high cost, easy cytotoxicity, and large side effects, and achieve efficient editing, good application prospects, safe and efficient editing effects

Active Publication Date: 2018-01-09
SHANGHAI INST OF APPLIED PHYSICS - CHINESE ACAD OF SCI
View PDF1 Cites 36 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a CRISPR / Cas9 T intracellular delivery system mediated by magnetic nanomaterials and its preparation method and application, so as to solve the problem of high cost, large side effects, cumbersome process and even easy treatment of tumor immunotherapy in the prior art. Problems with Cytotoxicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Magnetic nanomaterial-mediated CRISPR/Cas9 T-cell internal delivery system and preparation method and application thereof
  • Magnetic nanomaterial-mediated CRISPR/Cas9 T-cell internal delivery system and preparation method and application thereof
  • Magnetic nanomaterial-mediated CRISPR/Cas9 T-cell internal delivery system and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1 Construction of CRISPR-Cas9 specific knockout human PD-1 gene plasmid vector

[0043] Obtain sgRNA double-stranded (DNA double-stranded complementary to the target sgRNA) fragments. The sgRNA sequence targeting the human PD-1 gene is selected from the literature (Shu Su. et al. CRISPR-Cas9mediated efficient PD-1 disruption on human primary T cells from cancer patients. Scientific Reports 2016; 6:20070), forward strand: 5' - GCAGTTGTGTGACACGGAAG, reverse strand: 5'-CTTCCGTGTCACACAACTGC. According to the selected sgRNA target sequence, synthesize a pair of complementary DNA oligonucleotide chains (synthesized by Takara):

[0044] Forward strand S1: 5'-CACCGCAGTTGTGTGACACGGAAG (SEQ ID No: 1);

[0045] Reverse strand S2: 5'-AAACCTTCCGTGTCACACAACTGC (SEQ ID No: 2).

[0046] Anneal a pair of DNA oligonucleotide strands into double-stranded DNA. The annealing system (20 μL) is as follows: forward strand (100 μM) 1 μL; reverse strand (100 μM) 1 μL; sterilized water...

Embodiment 2

[0050] Example 2 Fe 3 o 4 Preparation of Nanoparticle-mediated CRISPR / Cas9 Intracellular Delivery System

[0051] Fe 3 o 4 Nanoparticles (single particle diameter 10nm, cluster particle diameter 5-200nm, Chemicell). Polyethyleneimine modifies this nanoparticle (see literature specifically: Cai Yuanyuan etc., PEI modifies magnetic Fe 3 o 4 Preparation and Characterization of Nanoparticles, Science and Technology Herald, 2010, 28, 68). Fe 3 o 4 Nanoparticle clusters were dispersed in an aqueous solution, and PEI solution (Sigma-aldrich, average Mw 800, product number 408719) diluted in Millipore water was added dropwise at a mass ratio of 1:8, stirred at 1400r / min for 30min to obtain PEI-modified Fe 3 o 4 Nanoparticles (Fe 3 o 4 -PEI). Under the action of a magnetic field, observe its magnetic field response ability.

[0052] Will Fe 3 o 4 -PEI and the plasmid targeting the knockout of human PD-1 gene were mixed in millipore pure water at a mass ratio of 10:1, inc...

Embodiment 3

[0054] Example 3 Fe 3 o 4 Comparison of Magnetic Field Response Forces of Nanoparticles in Cluster and Monodisperse Situations

[0055] Fe 3 o 4 Nanoparticles (monodisperse, Hangzhou Nanocrystal). PBS buffer and Fe 3 o 4 The nanoparticle solution (1mg / mL) was mixed in equal volumes and shaken at 350rpm for 2h to obtain Fe 3 o 4 Nanoparticle clusters, under the action of a magnetic field, observe their magnetic field responsiveness.

[0056] Result: Fe 3 o 4 The average particle size of nanometer monodisperse particles is 13nm, after adding PBS buffer solution, the formed Fe 3 o 4 The average particle size of the nanoclusters is 179nm. Fe 3 o 4 Nanoparticle single particle and cluster TEM images are shown in Figure 3A (left), Figure 3B (left), both have good water solubility. Under the action of a magnetic field, single particles have no obvious magnetic field response ability, while clusters have good magnetic field response ability, see respectively Figure ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
The average particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention provides a magnetic nanomaterial-mediated CRISPR / Cas9 T-cell internal delivery system and a preparation method and the application thereof. The preparation method comprises the followingsteps: 1) modifying a magnetic nanoparticle cluster with a certain size by using a cationic polymer to obtain a nanocarrier; 2) providing CRISPR / Cas9 system expression plasmids targeting a target gene; 3) co-incubating the nanocarrier obtained in the step 1) and the CRISPR / Cas9 system expression plasmids targeting the target gene to obtain a nanocomposite; 4) under the action of a magnetic field,co-incubating the nanocomposite obtained in the step 3) and a T cell to obtain the magnetic nanomaterial-mediated CRISPR / Cas9 T-cell internal delivery system. According to the invention, a method capable of simply, safely and efficiently editing the target gene in the T cell is provided; the magnetic nanomaterial-mediated CRISPR / Cas9 T-cell internal delivery system has a good application prospectin tumor immunotherapy.

Description

technical field [0001] The present invention relates to the field of biotechnology, more specifically to a CRISPR / Cas9 T intracellular delivery system mediated by magnetic nanomaterials and its preparation method and application. Background technique [0002] Tumor immunotherapy eliminates tumor cells by indirectly or directly activating human T cells. It has a good effect on the treatment of various tumors, especially advanced tumors, and has good safety. In 2013, this method was rated as the top ten scientific and technological breakthroughs of the year by Science. In the process of anti-tumor immunity, T cells are activated by antigen recognition signals mediated by T cell receptors (TCR), and numerous co-stimulatory signals and co-inhibitory signals finely regulate the intensity and quality of T cell responses. Inhibitory signals are immune checkpoints. Blockade against immune checkpoints is one of the effective strategies to enhance T cell activation. At present, ant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/87C12N15/90
Inventor 樊春海诸颖王丽华夏凯任宁孔华庭
Owner SHANGHAI INST OF APPLIED PHYSICS - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com