H genes and H protein for regulating formation of tomato type I glandular hairs and application thereof

A tomato and gene technology, applied in the application, genetic engineering, plant genetic improvement and other directions, can solve the problems such as the lack of thorough research on the regulation mechanism of the regulating gene, and achieve the effect of enhancing the ability of insect resistance and virus prevention, and increasing the density of glandular hairs.

Inactive Publication Date: 2018-01-30
HUAZHONG AGRICULTURAL UNIVERSITY
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on the genes related to the regulation of tomato epidermis, the regulatory pathways and regulatory mechanisms of the regulatory genes is not thorough.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • H genes and H protein for regulating formation of tomato type I glandular hairs and application thereof
  • H genes and H protein for regulating formation of tomato type I glandular hairs and application thereof
  • H genes and H protein for regulating formation of tomato type I glandular hairs and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Precise positioning and cloning of the H gene of the present invention

[0040] The phenotype of the h mutant LA3172 showed loss of epidermal hairs ( figure 2 , A is the glandular trichome phenotype of common tomato containing H gene; B is the glandular trichome phenotype of h mutant). In order to clone this key gene, this example uses Ailsa Craig (AC) and IL10-2 (an introgression line constructed by crossing the wild tomato species Panali and cultivar M82) to construct the F2 isolate group map, and screen out the F2 isolate group The genotypes of 94 epidermis-deficient individuals were detected with molecular markers TG408, CT203, TG420 and CT42, and their phenotypes and genotypes were converted into analyzable data for analysis. Linkage analysis showed that the H gene was located between molecular markers CT203 and TG420, with 1 crossover and 3 crossovers, respectively. According to the physical positions of these two markers, the H gene is located on chromosome 10...

Embodiment 2

[0045] Cloning and sequence analysis of H gene

[0046] According to the information of the candidate H gene, PCR-specific primers capable of amplifying the full length of the gene were designed. The forward primer was 5' gcctcgagaacacactcacacacacacaaaatc3' (SEQ ID NO: 19), and the reverse primer was 5' gcggtaccgaaaatagagcagacagaaaaacaa 3' (SEQ ID NO:20). Genomic RNA was extracted from tomato leaves, the RNA was reverse-transcribed into cDNA using a reverse transcriptase kit (purchased from Transgen), and the full-length H gene product was obtained by PCR amplification, which was detected by 1% agarose gel and recovered with a recovery reagent The target fragment was recovered from the kit (purchased from Axgen Company), cloned with the pEasy-Blunt vector (purchased from Transgen Company), and 5 μL of the ligated product was taken for heat shock treatment. Refer to the kit instructions for specific methods, transform Escherichia coli DH5α, and smear it on On the LB solid plat...

Embodiment 3

[0050] Functional verification of the H gene

[0051] Utilize the specific primers (SEQ ID NO:19 and SEQ ID NO:20) of the designed H gene, use high-fidelity DNA polymerase enzyme (purchased from Transgen Company), amplify the full-length cDNA sequence of H gene from Ailsa Craig, After the amplified product was gel-cut and recovered (the recovery kit was purchased from Axgen), it was connected to the pEASY-Blunt intermediate vector (purchased from Transgen), and the correct positive clone was selected by sequencing, and the target clone was digested with XbaI and KpnI. To clone the full-length fragment of gene H into the pEASY-Blunt vector, cut the pMV2 expression vector with XbaI and KpnI at the same time, recover and ligate to obtain the recombinant overexpression vector pMV2-H containing the H gene, see Figure 4 , the vector is driven by the 35S promoter, and the selectable marker gene is Spectinomycin (Spec). The overexpression vector pMV2-H of the H gene was transformed ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to H genes and H protein for regulating formation of tomato type I glandular hairs and application of the H genes and H protein for regulating the formation of the tomato type Iglandular hairs, and belongs to the technical field of plant genetic engineering. The cDNA nucleotide sequence of the H genes for regulating the formation of the tomato type I glandular hairs providedby the invention is as shown in SEQ ID NO: 1. The H genes provided by the invention can regulate the formation of the tomato type I glandular hairs. The H genes play a significant role in regulatingthe formation of the tomato type I glandular hairs, and can be applied to the aspects of tomato insect resistance, virus resistance, stress resistance and the like.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to an H gene and H protein for regulating the formation of tomato type I glandular trichomes and applications thereof. Background technique [0002] Plant epidermis has important anti-insect and anti-virus functions. Because of its simple structure and easy observation, it is a very important tool for studying the regulation of plant cell fate (including cell proliferation, cell cycle regulation, cell differentiation and cell fate determination). model. According to the number of cells, the epidermal hairs can be divided into unicellular and multicellular epidermal hairs; according to the presence or absence of glands, the epidermal hairs can be divided into glandular hairs and non-glandular hairs. As the first barrier of plant defense, epidermal hairs can delay, expel, and poison the damage of herbivorous pests through spatial barriers and secrete secondary metab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/82C07K14/415A01H5/00A01H6/82
Inventor叶志彪杨长宪常江朱顺华解庆敏
OwnerHUAZHONG AGRICULTURAL UNIVERSITY