A Molecular Marker for Controlling Flowering Period of Brassica napus and Its Application

A technology of molecular markers and flowering period, applied in the field of rapeseed genetic engineering

Inactive Publication Date: 2021-03-02
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cloning photoperiod pathway genes in rapeseed and using them for assisted selection of early maturity traits has not been reported and applied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Molecular Marker for Controlling Flowering Period of Brassica napus and Its Application
  • A Molecular Marker for Controlling Flowering Period of Brassica napus and Its Application
  • A Molecular Marker for Controlling Flowering Period of Brassica napus and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Cloning of Brassica napus BnaA10.CO gene

[0032] (1) Use specific primers (as shown below) to test the winter rape variety Tapidor (provided by the Rape Research Laboratory of Huazhong Agricultural University, see Table 1 for the original source) and the spring rape variety Westar (provided by the Rape Research Laboratory of Huazhong Agricultural University, see the original source in Table 1) 1) and an additional 11 winter rapeseed, 7 spring rapeseed and 9 semi-winter rapeseed (provided by Huazhong Agricultural University Rapeseed Research Laboratory, which is a conventional rapeseed resource, see Table 1 for the original source) of the Open-reading frame of BnA10.CO (ORF) were amplified separately. The primers for the amplification of the BnA10.CO gene (the gene ID in the rapeseed reference genome "Darmor-bzh" is BnaA10g18430D) are BnA10.CO-F (ACCATCACACTTAATTACTACATCA) and BnA10.CO-R (TACAGGTTAGCAATTCTAGTATTCTT).

[0033] (2) KOD-plus-standard reaction s...

Embodiment 2

[0042] Example 2: Identification of Brassica napus BnaA10.CO haplotype

[0043] (1) Using Clustal Omega (http: / / www.ebi.ac.uk / Tools / msa / clustalo / ) to compare the sequences of the cloned BnaA10.CO gene coding regions of winter rape, spring rape and semiwinter rape.

[0044] (2) The results are shown in Table 2. There are base mutations and InDel mutations in exons, of which there are 7 non-synonymous mutations. Winter rapeseed only contains haplotype 1, and spring rapeseed only contains haplotype 2. But semiwinter rape contains two haplotypes. See Table 2.

[0045] Table 2 Nucleotides in the coding region that cause amino acid variation in BnaA10.CO

[0046]

Embodiment 3

[0047] Example 3: Identification of functional differences of BnaA10.CO alleles in Brassica napus

[0048] (1) Use specific primers (as shown below) to detect winter rape Tapidor (provided by the Rape Research Laboratory of Huazhong Agricultural University, see Table 1 for the original source) and spring rape Westar (provided by the Rape Research Laboratory of Huazhong Agricultural University, see Table 1 for the original source) The genomic DNA of the gene was amplified to obtain a PCR product containing a promoter and a 4kb fragment of the full length of the gene. The amplification product is as follows: EcoRI_Pro_CO.A10-F (CCG GAATTC AAATGTAAGAGCCACTTGAATGC) and PstⅠ_Ter_CO.A10-R (AA CT GCAG GGTAAGGCAAGTAACCAGTCTC); wherein, the sequence marked in bold is the protected base, and the sequence marked underlined is the restriction site.

[0049] (2) KOD-plus-standard reaction system (TOYOBO) was used for gene amplification. The 50μl PCR reaction system included: 100ng ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular marker screening. The invention relates to a molecular marker and application for controlling flowering period of Brassica napus. The molecular marker is cloned from the BnaA10.CO gene, which is located on the A10 chromosome of Brassica napus and is a key gene of the photoperiod pathway in the flowering regulation network. The BnaA10.CO gene fragment was cloned from winter rapeseed and spring rapeseed, and the sequences of the fragments are shown in SEQ ID NO: 1 and SEQ ID NO: 3. Molecular marker primers related to flowering stage are shown in SEQ ID NO:5 and SEQ ID NO:6. The transformation confirmed that the gene was derived from the allele of winter rapeseed, and the effect of promoting flowering was stronger than that of the allele of spring rapeseed. Alleles derived from winter rapeseed can shorten the growth period of semiwinter rapeseed. The molecular markers developed according to the InDel difference at position 25-27 of the BnA10.CO gene region can be used for early-maturing breeding of rapeseed.

Description

technical field [0001] The invention belongs to the field of rapeseed genetic engineering, and in particular relates to a molecular marker for controlling the flowering stage of Brassica napus and the preparation and application of a molecular marker. The molecular marker of the present invention is derived from the BnaA10.CO gene, which is located on the A10 chromosome of Brassica napus and is a key gene of the photoperiod pathway in the flowering period regulation network. The invention discloses BnaA10.CO obtained by isolating and cloning from winter, semi-winter and spring rapeseed. The invention also relates to the development of a molecular marker using the gene fragment and its application in breeding for early maturity traits in rapeseed. Background technique [0002] Brassica napus is an important oil crop widely grown in the world. Rapeseed oil can not only be used as edible oil, but also industrial raw materials such as lubricating oil and biodiesel. In the near...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13
Inventor王晶刘克德李海涛李娟娟郭涛殷帅
OwnerHUAZHONG AGRI UNIV