Molecular marker for controlling flowering phase of cabbage type rape and applications of molecular marker
A technique for molecular markers and flowering stages, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Cloning of Brassica napus BnaA10.CO gene
[0032] (1) Use specific primers (as shown below) to test the winter rape variety Tapidor (provided by the Rape Research Laboratory of Huazhong Agricultural University, see Table 1 for the original source) and the spring rape variety Westar (provided by the Rape Research Laboratory of Huazhong Agricultural University, see the original source in Table 1) 1) and an additional 11 winter rapeseed, 7 spring rapeseed and 9 semi-winter rapeseed (provided by Huazhong Agricultural University Rapeseed Research Laboratory, which is a conventional rapeseed resource, see Table 1 for the original source) of the Open-reading frame of BnA10.CO (ORF) were amplified separately. The primers for the amplification of the BnA10.CO gene (the gene ID in the rapeseed reference genome "Darmor-bzh" is BnaA10g18430D) are BnA10.CO-F (ACCATCACACTTAATTACTACATCA) and BnA10.CO-R (TACAGGTTAGCAATTCTAGTATTCTT).
[0033] (2) KOD-plus-standard reaction s...
Embodiment 2
[0042] Example 2: Identification of Brassica napus BnaA10.CO haplotype
[0043] (1) Using Clustal Omega (http: / / www.ebi.ac.uk / Tools / msa / clustalo / ) to compare the sequences of the cloned BnaA10.CO gene coding regions of winter rape, spring rape and semiwinter rape.
[0044] (2) The results are shown in Table 2. There are base mutations and InDel mutations in exons, of which there are 7 non-synonymous mutations. Winter rapeseed only contains haplotype 1, and spring rapeseed only contains haplotype 2. But semiwinter rape contains two haplotypes. See Table 2.
[0045] Table 2 Nucleotides in the coding region that cause amino acid variation in BnaA10.CO
[0046]
Embodiment 3
[0047] Example 3: Identification of functional differences of BnaA10.CO alleles in Brassica napus
[0048] (1) Use specific primers (as shown below) to detect winter rape Tapidor (provided by the Rape Research Laboratory of Huazhong Agricultural University, see Table 1 for the original source) and spring rape Westar (provided by the Rape Research Laboratory of Huazhong Agricultural University, see Table 1 for the original source) The genomic DNA of the gene was amplified to obtain a PCR product containing a promoter and a 4kb fragment of the full length of the gene. The amplification product is as follows: EcoRI_Pro_CO.A10-F (CCG GAATTC AAATGTAAGAGCCACTTGAATGC) and PstⅠ_Ter_CO.A10-R (AA CTGCAG GGTAAGGCAAGTAACCAGTCTC); wherein, the sequence marked in bold is the protected base, and the sequence marked underlined is the restriction site.
[0049] (2) KOD-plus-standard reaction system (TOYOBO) was used for gene amplification. The 50μl PCR reaction system included: 100ng genom...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


