Neutral protease gene built by molecular chaperone DnaK, protein, bacillus subtilis, and preparation and application of neutral protease gene built by molecular chaperone
A technology of Bacillus subtilis and neutral protease, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as fire hazards, restriction of enzyme secretion and expression, and reduction of enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0078] 1. The neutral protease gene constructed by molecular chaperone DnaK, its gene sequence is:
[0079]gctgagaatcctcagcttaaagaaaacctgacgaactttgtgccgaagcattctttggtgcaatctgaattgccttcagtcagtgacaaagcaatcaagcaatacttgaaacaaaacggcaaagtcttcaaaggcaacccttctgagagactgaagctaattgaccacacgaccgatgatctcggctacaagcacttccgttatgtgcctgtcgttaacggtgtgcctgtgaaagactcgcaagtcattattcacgtcgataaatccaacaatgtctatgcgattaacggagaattaaacaacgatgcttctgccaaaacggcaaacagcaaaaaattatctgcaaatcaagcgctggatcatgcttttaaagcaatcggcaaatcacctgaagccgtctctaacggcaacgttgcaaacaaaaacaaagccgagctgaaagcagcggccacaaaagacggtaaataccgactcgcctatgatgtaaccatccgctacatcgaaccggaaccagctaactgggaagtaaccgttgatgcggaaacagggaaagtcctgaaaaagcaaaacaaagtggagcatgccgctgcaaccggaacaggtacgactcttaaaggaaaaacggtctcattaaatatttcttctgaaagcggcaaatatgtaatgcgtgatctttctaaacctaccggaacgcaaattattacgtacgatctgcaaaaccgacaatataacctgccgggcacgctcgtatcaagcactacaaaccagttcacaacttcttctcagcgcgctgccgttgatgcgcattacaatctcggcaaagtgtacgattatttctatcagacgtttaaacgcaacagctacgacaataaaggcggcaaaatcgt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



