Molecular maker applied to sepiella maindroni and sepia esculenta interspecies identification and application
A technology of needleless cuttlefish and molecular markers, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc. It can solve the problems of distinguishing different species, difficult species identification, cumbersome process, etc., and achieves applicability Extensive, clear and intuitive results, and simple and easy methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Identification of Sepia mansoni and Golden Squid in the genus Sepia:
[0031] a. Acquisition of the basis sequence for species identification: the COI gene sequence of different closely related squid species in the genus Sepia, which is relatively common in my country, is used as the basis sequence for species identification;
[0032] b. Primer design: select the sequence region that can clearly distinguish the target species in the above-mentioned Sepia COI gene, and use
[0033] Use Primer Premier5 software to design PCR amplification primers in this region. The primer amplification products should have obvious Tm value differences among different species, mainly reflected in the different C and T contents.
[0034] The forward primer F1 is: 5'CAGGAACAGTTTCCACTACCCCTAC 3';
[0035] Reverse primer F2 is 5'CGCGTACATATCGCCCGTC 3'.
[0036] c. PCR amplification: using the genomic DNA of the cuttlefish sample to be identified as a template, PCR amplification was performe...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com