Molecular maker applied to sepiella maindroni and sepia esculenta interspecies identification and application

A technology of needleless cuttlefish and molecular markers, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc. It can solve the problems of distinguishing different species, difficult species identification, cumbersome process, etc., and achieves applicability Extensive, clear and intuitive results, and simple and easy methods

Inactive Publication Date: 2018-04-13
NINGBO UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the most common way is to use the difference of mitochondrial COI gene and ITS sequence as the classification basis to distinguish different species, but the difference between these gene sequences is often SNP or In / del, and the change of sequence length between different species is not obvious , so it is difficult to distinguish different species by electrophoresis and other methods; sequencing can obtain detailed base information of this gene or sequence, but the sequencing experiment process is cumbersome and expensive, and requires the support of large instruments, which is difficult to achieve in a short time Accurate, fast and easy species identification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular maker applied to sepiella maindroni and sepia esculenta interspecies identification and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Identification of Sepia mansoni and Golden Squid in the genus Sepia:

[0031] a. Acquisition of the basis sequence for species identification: the COI gene sequence of different closely related squid species in the genus Sepia, which is relatively common in my country, is used as the basis sequence for species identification;

[0032] b. Primer design: select the sequence region that can clearly distinguish the target species in the above-mentioned Sepia COI gene, and use

[0033] Use Primer Premier5 software to design PCR amplification primers in this region. The primer amplification products should have obvious Tm value differences among different species, mainly reflected in the different C and T contents.

[0034] The forward primer F1 is: 5'CAGGAACAGTTTCCACTACCCCTAC 3';

[0035] Reverse primer F2 is 5'CGCGTACATATCGCCCGTC 3'.

[0036] c. PCR amplification: using the genomic DNA of the cuttlefish sample to be identified as a template, PCR amplification was performe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a technique of sibling species identification, and in particular to a method for sepia sibling species identification. Specifically, the method comprises the following steps:with sepia genome DNA as a template, designing a primer in accordance with a tag sequence of the sepia species genome; and on the basis of Tm value difference of an amplification value in a high-resolution melting curve (HRM), distinguishing sepia species. With the application of the method provided by the invention, species identification can be implemented rapidly, economically and conveniently;and the accuracy rate of the method, in comparison with a tag sequence sequencing result, is 100%.

Description

technical field [0001] The invention belongs to the technical field of squid species identification, and in particular relates to a molecular marker that can be used for interspecies identification of squid mansoni and squid and its application. Background technique [0002] The main squid species in the East my country Sea of ​​China are Sepiella maindroni and Sepia esculenta Hoyle, both of which are called cuttlefish and mullet, belonging to the phylum Mollusca, class Cephalopoda, and two-branched squid. Dibranchia, Decapoda, Sepiacea, Sepiidae, and Sepiella are important fishing species in my country's coastal waters. Both have good nutritional value and have certain medicinal value; their meat is as white as jade, fresh, tender and crisp, and rich in nutrition. Every 100 grams of meat contains 13 grams of protein, 0.7 grams of fat and rich calcium and phosphorus. ,iron. In addition to eating fresh, it can also be processed into canned food or dry products. The dried sq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6888C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6888C12Q2600/156C12Q2531/113C12Q2527/107
Inventor 李荣华卢少坤陈炼王春琳宋微微母昌考刘磊史策
Owner NINGBO UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap