Application of PGC-1[alpha] specific RNA interfering adenovirus
A technology of RNA interference and PGC-1, which is applied in double-stranded DNA viruses, applications, viruses, etc., can solve the problems of less research on PGC-1α and unclear effects, etc., to increase survival time, prolong survival time, and enhance therapeutic effects Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] 1. According to the mRNA sequence of the PGC-1α gene (NM_013261) provided by Genebank, a pair of primers were designed and synthesized using the RNAi design program of Invitrogen, USA, for the preparation of PGC-1a-specific shRNA. The primer sequences are as follows:
[0028] Upstream primers:
[0029] CCGGGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTCTTTTTG,
[0030] Downstream primers:
[0031] AATTCAAAAAGACTATTGCCAGTCAATTAATCTCGAGATTAATTGACTGGCAATAGTC.
[0032] After annealing to form double-stranded DNA (according to the conventional 50 μL annealing system, including 5 μL upstream primer, 5 μL downstream primer, 5 μL commercial 10x NEB buffer, 35 μL ddH 2 0; naturally cool to room temperature in boiling water bath for 5 minutes to complete the annealing), under the action of commercial T4DNA ligase (NEB), it is connected with the sticky end of the linearized shuttle vector pENTRTM / U6 (Addgene); the ligation product is transformed into Ecoli .DH5a competent cells...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com