Application of reagent detecting expression level of long non-coding RAN PVT1 through in situ hybridization in preparation of diagnostic reagent of nasopharyngeal carcinoma
A long-chain non-coding and in situ hybridization technology, which is applied in the preparation of nasopharyngeal carcinoma diagnostic reagents and in situ hybridization to detect long-chain non-coding RNAPVT1 reagents, which can solve the problems of poor prognosis, inability to completely kill tumor cells by radiation, and patient death And other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1, real-time fluorescent quantitative PCR method detection confirmed that PVT1 was up-regulated in nasopharyngeal carcinoma
[0031] 1. Materials and methods:
[0032] 32 cases of normal nasopharyngeal epithelial tissues and 61 cases of nasopharyngeal carcinoma tissues were collected, total RNA was extracted, 2 μg RNA was reverse transcribed into cDNA, and real-time fluorescent quantitative PCR was performed. PVT1 forward primer is 5'-TGG CTG AGA GGG TTG AGA TC-3' as shown in SEQ NO:2, and reverse primer 5'-GCT GTA TGT GCC AAG GTC AC-3' as shown in SEQ NO:3 .
[0033]The GAPDH forward primer used for the control is 5'-ACCACAGTCCATGCCATCAC-3' as shown in SEQ NO:4, and the reverse primer 5'-TCCACCACCCTGTTGCTGTA-3' as shown in SEQ NO:5.
[0034] Real-time fluorescence quantitative PCR reaction system
[0035]
[0036] Real-time fluorescent quantitative PCR reaction steps
[0037]
[0038]
[0039] After the reaction, the amplification curve and melting...
Embodiment 2
[0042] Example 2, In situ hybridization detection found the expression of PVT1 in nasopharyngeal carcinoma, and its correlation with patient prognosis and radiotherapy sensitivity
[0043] 1. Material method
[0044] 1.1 Design and synthesis of hybridization probes
[0045] In order to detect the expression of PVT1 by in situ hybridization, we designed two groups of oligonucleotide probes for detection of PVT1 expression by in situ hybridization and three positive control in situ hybridization oligonucleotide probes.
[0046] Oligonucleotide probes for detection of PVT1 expression by in situ hybridization:
[0047] PVT1 probe 1: 5'-GGTCGGACTAGAAAACCGGTCTTCCTCTAATTTT-3' as shown in SEQ NO:6,
[0048] PVT1 probe 2: 5'-GAGACTGTAAAAACTTCTCAGGTCTTAGGA-3' as shown in SEQ NO:7,
[0049] PVT1 probe 3: 5'-CTCATAAAACTCTAACCTCTTAATTCTCGGTCAG-3' is shown in SEQ NO:8.
[0050] Positive control probe (to detect the housekeeping gene GAPDH):
[0051] GAPDH probe 1: 5'-CCACTTTACCAGAGTTAA...
Embodiment 3
[0115] Example 3, construction of shRNA vectors to interfere with the expression of PVT1
[0116] 1. Material method
[0117] 1.1 Reagents and kits
[0118] Restriction enzymes Hind III, Bgl II, EcoR I and Cla I, T4 DNA ligase, etc. were purchased from TakaRa;
[0119] TRIZOL TM Reagent (Invitrogen);
[0120] Plasmid Extraction Kit (#D6943-01, OMEGA);
[0121] Gel recovery kit (#M5212, OMEGA);
[0122] Reverse transcription kit (#A3500, Promega);
[0123] Antibiotic G418 (Ameresc).
[0124] 1.2 Design of shRNA
[0125] First, input the PVT1 sequence into Invitrogen's Block-It RNAi designer software to find the best shRNA target of the lncRNA, and select the best 3 corresponding target sequences as follows:
[0126] shRNA-1: GGACTTGAGAACTGTCCTTA as shown in SEQ NO: 12,
[0127] shRNA-2: GCTTCTCCTGTTGCTGCTAGT as shown in SEQ NO: 13,
[0128] shRNA-3: GCTCCACCCAGAAGCAATTCA shown in SEQ NO: 14,
[0129] The widely used Scramble sequence without any target in the human ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More